Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224661319:

Variant ID: vg0224661319 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24661319
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, C: 0.20, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAAATGATAAAAAATTAATAATTACTTAAATTTTTTTAATAAGATAAACGGTCAAATATATTTAAAAAAGTTAAAAGCGTTAAATATTTAGAAACGGA[G/C]
ACGGTAGATAGTTTGGGTCGAGACGCGCGGGCGCCGGGCGGCTCTCGGCTCTCTCGTGGAGTTCCGCCCGCCGGCGCAGACGACGGGGGAGACGACTGCG

Reverse complement sequence

CGCAGTCGTCTCCCCCGTCGTCTGCGCCGGCGGGCGGAACTCCACGAGAGAGCCGAGAGCCGCCCGGCGCCCGCGCGTCTCGACCCAAACTATCTACCGT[C/G]
TCCGTTTCTAAATATTTAACGCTTTTAACTTTTTTAAATATATTTGACCGTTTATCTTATTAAAAAAATTTAAGTAATTATTAATTTTTTATCATTTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 29.90% 6.88% 19.28% NA
All Indica  2759 24.10% 39.10% 8.84% 27.91% NA
All Japonica  1512 74.70% 16.10% 3.64% 5.49% NA
Aus  269 56.90% 22.70% 5.95% 14.50% NA
Indica I  595 10.30% 16.30% 10.08% 63.36% NA
Indica II  465 18.10% 44.90% 8.82% 28.17% NA
Indica III  913 30.10% 50.90% 8.65% 10.30% NA
Indica Intermediate  786 31.20% 39.30% 8.14% 21.37% NA
Temperate Japonica  767 84.60% 5.90% 3.78% 5.74% NA
Tropical Japonica  504 56.30% 33.70% 3.97% 5.95% NA
Japonica Intermediate  241 81.70% 12.00% 2.49% 3.73% NA
VI/Aromatic  96 80.20% 6.20% 6.25% 7.29% NA
Intermediate  90 58.90% 23.30% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224661319 G -> DEL N N silent_mutation Average:87.621; most accessible tissue: Zhenshan97 panicle, score: 97.468 N N N N
vg0224661319 G -> C LOC_Os02g40664-LOC_Os02g40680 intergenic_region ; MODIFIER silent_mutation Average:87.621; most accessible tissue: Zhenshan97 panicle, score: 97.468 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224661319 G C -0.05 0.0 0.02 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224661319 NA 2.36E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 8.82E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 3.47E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 1.35E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 2.66E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 1.57E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 9.05E-08 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 2.77E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 7.57E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 1.25E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 9.38E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 6.50E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 1.19E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 5.56E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 1.88E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 1.04E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 2.38E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 2.72E-07 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 4.34E-08 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 6.17E-08 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 5.59E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 8.41E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 4.33E-08 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 6.56E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 1.39E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 1.48E-10 mr1558_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 4.80E-10 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 6.49E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 6.85E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224661319 NA 1.42E-08 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251