Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224644316:

Variant ID: vg0224644316 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24644316
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTGAAAGTGTTTTTTTTTCTTGACGCATCTGGCATCCTGGTGTTAATGATCAAGTGATCTCTCAAAATTCAAGTAATCATTCGTAATAGTGGATTCATG[A/T]
GAGAGATTTTATAAAGGAACTACCCATGTAACTTTCCATTGAGAAGTTCCTAAAAACTTTATTAAGATATAATTACAATATAAAACTAATATAGGTACAT

Reverse complement sequence

ATGTACCTATATTAGTTTTATATTGTAATTATATCTTAATAAAGTTTTTAGGAACTTCTCAATGGAAAGTTACATGGGTAGTTCCTTTATAAAATCTCTC[T/A]
CATGAATCCACTATTACGAATGATTACTTGAATTTTGAGAGATCACTTGATCATTAACACCAGGATGCCAGATGCGTCAAGAAAAAAAAACACTTTCAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	30.30%	0.21%	0.02%	NA
All Indica	2759	72.10%	27.60%	0.22%	0.04%	NA
All Japonica	1512	65.60%	34.20%	0.20%	0.00%	NA
Aus	269	72.90%	27.10%	0.00%	0.00%	NA
Indica I	595	89.40%	10.60%	0.00%	0.00%	NA
Indica II	465	75.50%	24.50%	0.00%	0.00%	NA
Indica III	913	57.10%	42.60%	0.22%	0.11%	NA
Indica Intermediate	786	74.60%	24.90%	0.51%	0.00%	NA
Temperate Japonica	767	74.40%	25.30%	0.26%	0.00%	NA
Tropical Japonica	504	56.50%	43.50%	0.00%	0.00%	NA
Japonica Intermediate	241	56.40%	43.20%	0.41%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224644316	A -> T	LOC_Os02g40640.1	upstream_gene_variant ; 2335.0bp to feature; MODIFIER	silent_mutation	Average:48.669; most accessible tissue: Callus, score: 89.077	N	N	N	N
vg0224644316	A -> T	LOC_Os02g40650.1	downstream_gene_variant ; 258.0bp to feature; MODIFIER	silent_mutation	Average:48.669; most accessible tissue: Callus, score: 89.077	N	N	N	N
vg0224644316	A -> T	LOC_Os02g40664.1	downstream_gene_variant ; 1182.0bp to feature; MODIFIER	silent_mutation	Average:48.669; most accessible tissue: Callus, score: 89.077	N	N	N	N
vg0224644316	A -> T	LOC_Os02g40650-LOC_Os02g40664	intergenic_region ; MODIFIER	silent_mutation	Average:48.669; most accessible tissue: Callus, score: 89.077	N	N	N	N
vg0224644316	A -> DEL	N	N	silent_mutation	Average:48.669; most accessible tissue: Callus, score: 89.077	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224644316	NA	4.32E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224644316	NA	3.86E-06	mr1324_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224644316	NA	3.96E-06	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224644316	NA	2.70E-06	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224644316	7.59E-07	7.59E-07	mr1744_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251