\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224633236:

Variant ID: vg0224633236 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24633236
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGGCAAAATCTAAATGGCATGAAGCCTTCTCGCCGACTCTCGTCCTGCACTCATCCCACCTGTTCCGCTTCTGCAGATTGACGTCAAACATCACTTGA[G/A]
CGCTCCTAAGGGCTTTCACAGTGTAGTGATGTGGCATTCAGCCTCAAGCTTACACATAGGAGATTCTCAGCCACGTGTGCATTTCACGTGACTAAACCAA

Reverse complement sequence

TTGGTTTAGTCACGTGAAATGCACACGTGGCTGAGAATCTCCTATGTGTAAGCTTGAGGCTGAATGCCACATCACTACACTGTGAAAGCCCTTAGGAGCG[C/T]
TCAAGTGATGTTTGACGTCAATCTGCAGAAGCGGAACAGGTGGGATGAGTGCAGGACGAGAGTCGGCGAGAAGGCTTCATGCCATTTAGATTTTGCCGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 43.90% 0.11% 0.00% NA
All Indica  2759 54.70% 45.10% 0.14% 0.00% NA
All Japonica  1512 58.20% 41.70% 0.07% 0.00% NA
Aus  269 52.00% 48.00% 0.00% 0.00% NA
Indica I  595 20.50% 79.30% 0.17% 0.00% NA
Indica II  465 63.90% 36.10% 0.00% 0.00% NA
Indica III  913 69.10% 30.70% 0.22% 0.00% NA
Indica Intermediate  786 58.50% 41.30% 0.13% 0.00% NA
Temperate Japonica  767 57.80% 42.20% 0.00% 0.00% NA
Tropical Japonica  504 62.90% 37.10% 0.00% 0.00% NA
Japonica Intermediate  241 49.80% 49.80% 0.41% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224633236 G -> A LOC_Os02g40610.1 upstream_gene_variant ; 1926.0bp to feature; MODIFIER silent_mutation Average:45.403; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0224633236 G -> A LOC_Os02g40620.1 upstream_gene_variant ; 688.0bp to feature; MODIFIER silent_mutation Average:45.403; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0224633236 G -> A LOC_Os02g40630.1 downstream_gene_variant ; 2326.0bp to feature; MODIFIER silent_mutation Average:45.403; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0224633236 G -> A LOC_Os02g40620-LOC_Os02g40630 intergenic_region ; MODIFIER silent_mutation Average:45.403; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224633236 NA 3.34E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.22E-09 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.07E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 3.29E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 6.34E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.66E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.83E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 4.94E-08 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 3.59E-07 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 9.47E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 9.99E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 6.67E-09 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 3.23E-08 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 2.55E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.41E-09 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 7.98E-09 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 5.56E-10 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 6.86E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.46E-07 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 4.89E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.46E-08 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 3.11E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 8.94E-07 1.46E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 1.09E-06 4.91E-08 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 4.98E-08 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 4.18E-09 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.29E-10 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.95E-08 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 4.93E-09 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 5.21E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 6.98E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 1.97E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 2.24E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 NA 2.90E-12 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 7.88E-06 8.82E-09 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224633236 5.36E-07 5.50E-12 mr1962_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251