Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224628475:

Variant ID: vg0224628475 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 24628475
Reference Allele: C	Alternative Allele: T,CGT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAACTCCTTATTTCGGAAAATTCAGTGATTCCGTTCCTTTCATATTTCCCATGAGACTAGGAGAATTATGGATCAAGTACTACGCTTGGGTGCGCTCTGA[C/T,CGT]
GTGTTGCAAGTGACTCCCACCAATCATAGACTGGGTCACATGCACCCAGTTTGTTGGTTTGATGGGGTTATAGGCTATCTAGTTGGCAATGGTGTCTTAG

Reverse complement sequence

CTAAGACACCATTGCCAACTAGATAGCCTATAACCCCATCAAACCAACAAACTGGGTGCATGTGACCCAGTCTATGATTGGTGGGAGTCACTTGCAACAC[G/A,ACG]
TCAGAGCGCACCCAAGCGTAGTACTTGATCCATAATTCTCCTAGTCTCATGGGAAATATGAAAGGAACGGAATCACTGAATTTTCCGAAATAAGGAGTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.30%	18.60%	0.59%	7.24%	CGT: 10.28%
All Indica	2759	55.40%	28.20%	0.18%	2.90%	CGT: 13.34%
All Japonica	1512	82.60%	0.60%	0.93%	15.67%	CGT: 0.20%
Aus	269	31.60%	22.70%	3.35%	1.86%	CGT: 40.52%
Indica I	595	28.10%	69.70%	0.34%	1.68%	CGT: 0.17%
Indica II	465	38.50%	22.80%	0.00%	1.29%	CGT: 37.42%
Indica III	913	80.90%	9.50%	0.22%	3.83%	CGT: 5.48%
Indica Intermediate	786	56.40%	21.60%	0.13%	3.69%	CGT: 18.19%
Temperate Japonica	767	81.20%	0.10%	1.04%	17.34%	CGT: 0.26%
Tropical Japonica	504	87.70%	1.20%	0.60%	10.32%	CGT: 0.20%
Japonica Intermediate	241	76.30%	0.80%	1.24%	21.58%	NA
VI/Aromatic	96	66.70%	15.60%	0.00%	16.67%	CGT: 1.04%
Intermediate	90	74.40%	15.60%	0.00%	4.44%	CGT: 5.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224628475	C -> CGT	LOC_Os02g40590.1	upstream_gene_variant ; 3091.0bp to feature; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> CGT	LOC_Os02g40600.1	upstream_gene_variant ; 532.0bp to feature; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> CGT	LOC_Os02g40610.1	downstream_gene_variant ; 419.0bp to feature; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> CGT	LOC_Os02g40620.1	downstream_gene_variant ; 3329.0bp to feature; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> CGT	LOC_Os02g40600-LOC_Os02g40610	intergenic_region ; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> T	LOC_Os02g40590.1	upstream_gene_variant ; 3090.0bp to feature; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> T	LOC_Os02g40600.1	upstream_gene_variant ; 531.0bp to feature; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> T	LOC_Os02g40610.1	downstream_gene_variant ; 420.0bp to feature; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> T	LOC_Os02g40620.1	downstream_gene_variant ; 3330.0bp to feature; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> T	LOC_Os02g40600-LOC_Os02g40610	intergenic_region ; MODIFIER	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N
vg0224628475	C -> DEL	N	N	silent_mutation	Average:70.581; most accessible tissue: Callus, score: 99.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224628475	NA	8.01E-10	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	4.07E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	1.12E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	8.88E-08	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	2.83E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	2.53E-07	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	2.40E-06	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	8.83E-06	mr1254	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	9.10E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	7.78E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	2.79E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	1.86E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	8.48E-09	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	5.02E-11	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	2.43E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	1.25E-08	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	7.95E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	2.99E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	1.65E-07	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	3.69E-07	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	2.23E-07	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	1.90E-07	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	6.62E-10	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	5.98E-06	mr1146_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	1.27E-07	mr1148_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	6.09E-10	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	2.35E-11	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	9.83E-07	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	4.49E-08	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	9.17E-07	3.08E-08	mr1240_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	1.76E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	1.43E-07	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	4.88E-10	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	1.32E-06	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	2.12E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224628475	NA	4.47E-11	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251