| Variant ID: vg0224626347 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24626347 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTTAAGGGCTCATTTAGTTTAAAGAATTTTCGTAAGATTATTGTAGTAATTAAAATCTTAGTTTTTTTTTTCTATATGCATCATTTGTTTTATAGGATT[G/A]
GATCCTATCAAATTTCTAAGAATTGTAATCTTATAACCCTATTTCATACGATTCTTATCATGGGGTGAGAACTTTTGATAAAAATCCTAAGGAGTGGAGT
ACTCCACTCCTTAGGATTTTTATCAAAAGTTCTCACCCCATGATAAGAATCGTATGAAATAGGGTTATAAGATTACAATTCTTAGAAATTTGATAGGATC[C/T]
AATCCTATAAAACAAATGATGCATATAGAAAAAAAAAACTAAGATTTTAATTACTACAATAATCTTACGAAAATTCTTTAAACTAAATGAGCCCTTAAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 7.20% | 0.55% | 8.23% | NA |
| All Indica | 2759 | 86.70% | 9.50% | 0.33% | 3.48% | NA |
| All Japonica | 1512 | 82.50% | 1.70% | 0.79% | 15.01% | NA |
| Aus | 269 | 75.80% | 4.50% | 0.74% | 18.96% | NA |
| Indica I | 595 | 97.50% | 0.80% | 0.00% | 1.68% | NA |
| Indica II | 465 | 85.40% | 13.10% | 0.22% | 1.29% | NA |
| Indica III | 913 | 82.40% | 12.50% | 0.55% | 4.60% | NA |
| Indica Intermediate | 786 | 84.40% | 10.40% | 0.38% | 4.83% | NA |
| Temperate Japonica | 767 | 82.40% | 0.10% | 0.26% | 17.21% | NA |
| Tropical Japonica | 504 | 86.70% | 2.80% | 0.60% | 9.92% | NA |
| Japonica Intermediate | 241 | 73.90% | 4.60% | 2.90% | 18.67% | NA |
| VI/Aromatic | 96 | 45.80% | 39.60% | 3.12% | 11.46% | NA |
| Intermediate | 90 | 92.20% | 3.30% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224626347 | G -> A | LOC_Os02g40590.1 | upstream_gene_variant ; 962.0bp to feature; MODIFIER | silent_mutation | Average:27.856; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0224626347 | G -> A | LOC_Os02g40600.1 | downstream_gene_variant ; 863.0bp to feature; MODIFIER | silent_mutation | Average:27.856; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0224626347 | G -> A | LOC_Os02g40610.1 | downstream_gene_variant ; 2548.0bp to feature; MODIFIER | silent_mutation | Average:27.856; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0224626347 | G -> A | LOC_Os02g40590-LOC_Os02g40600 | intergenic_region ; MODIFIER | silent_mutation | Average:27.856; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0224626347 | G -> DEL | N | N | silent_mutation | Average:27.856; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224626347 | 4.11E-06 | NA | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 7.29E-07 | NA | mr1095_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 8.87E-06 | NA | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 6.37E-08 | NA | mr1098_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 1.19E-06 | NA | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 2.24E-08 | NA | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 3.01E-06 | NA | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 9.34E-07 | NA | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 2.75E-09 | NA | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 2.40E-06 | NA | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224626347 | 4.07E-06 | NA | mr1911_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |