\
| Variant ID: vg0224604930 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24604930 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACCCATGTCGTGTGTAGATTTGGCTGTCCCAAGAAAATTGTGTCAGACCGAGGCACTCAGTTCACCTCAAAGTTCTGGAAGCAGTTGCATGAAGCCCTC[G/A]
GAACCGATCTAAATTTATTACAGCCTACCATCCGCAGACCGATGGTCAGACAGAAAGGGTAAACCAAGTCCTAGAGGACATGCTACGTGCGTGTGCCCTG
CAGGGCACACGCACGTAGCATGTCCTCTAGGACTTGGTTTACCCTTTCTGTCTGACCATCGGTCTGCGGATGGTAGGCTGTAATAAATTTAGATCGGTTC[C/T]
GAGGGCTTCATGCAACTGCTTCCAGAACTTTGAGGTGAACTGAGTGCCTCGGTCTGACACAATTTTCTTGGGACAGCCAAATCTACACACGACATGGGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.00% | 3.70% | 25.90% | 22.43% | NA |
| All Indica | 2759 | 40.20% | 5.40% | 35.16% | 19.28% | NA |
| All Japonica | 1512 | 59.70% | 1.70% | 5.36% | 33.27% | NA |
| Aus | 269 | 47.60% | 0.00% | 50.19% | 2.23% | NA |
| Indica I | 595 | 10.40% | 17.60% | 33.61% | 38.32% | NA |
| Indica II | 465 | 20.90% | 6.90% | 47.10% | 25.16% | NA |
| Indica III | 913 | 70.10% | 0.00% | 26.40% | 3.50% | NA |
| Indica Intermediate | 786 | 39.30% | 1.50% | 39.44% | 19.72% | NA |
| Temperate Japonica | 767 | 58.10% | 3.10% | 2.61% | 36.11% | NA |
| Tropical Japonica | 504 | 64.90% | 0.00% | 9.72% | 25.40% | NA |
| Japonica Intermediate | 241 | 53.90% | 0.40% | 4.98% | 40.66% | NA |
| VI/Aromatic | 96 | 74.00% | 0.00% | 19.79% | 6.25% | NA |
| Intermediate | 90 | 64.40% | 0.00% | 21.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224604930 | G -> A | LOC_Os02g40570.1 | missense_variant ; p.Gly1586Arg; MODERATE | nonsynonymous_codon ; G1586R | Average:10.911; most accessible tissue: Callus, score: 19.188 | probably damaging |
2.747 |
DELETERIOUS | 0.00 |
| vg0224604930 | G -> DEL | LOC_Os02g40570.1 | N | frameshift_variant | Average:10.911; most accessible tissue: Callus, score: 19.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224604930 | 2.29E-09 | 4.43E-13 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224604930 | 6.54E-10 | 1.51E-11 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224604930 | 1.10E-08 | 4.31E-12 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224604930 | 7.15E-09 | 6.18E-11 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224604930 | 1.14E-08 | 5.88E-17 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224604930 | 1.69E-08 | 3.00E-15 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224604930 | 1.54E-06 | NA | mr1897_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |