Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224574434:

Variant ID: vg0224574434 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24574434
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAACTTCCAACTTTTCCATCACATCGAACTTTCCTACACACACAAACTTCCAACTTTTCCATCACATTGTTCCAATTTCTTCAAACTTCCAATTTTGG[T/C]
GTGGAACTAAACACAGCCTAAGTCAAGAACAATAAAAAAACTGTTCTACTTAGTAAAAAATGTCCGTACATCATCTGAGAATCAGTTCCAAAAACCCAAA

Reverse complement sequence

TTTGGGTTTTTGGAACTGATTCTCAGATGATGTACGGACATTTTTTACTAAGTAGAACAGTTTTTTTATTGTTCTTGACTTAGGCTGTGTTTAGTTCCAC[A/G]
CCAAAATTGGAAGTTTGAAGAAATTGGAACAATGTGATGGAAAAGTTGGAAGTTTGTGTGTGTAGGAAAGTTCGATGTGATGGAAAAGTTGGAAGTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	15.20%	2.43%	0.63%	NA
All Indica	2759	83.90%	12.50%	3.12%	0.51%	NA
All Japonica	1512	79.50%	19.80%	0.73%	0.00%	NA
Aus	269	82.90%	4.80%	6.32%	5.95%	NA
Indica I	595	87.20%	4.70%	8.07%	0.00%	NA
Indica II	465	78.10%	13.80%	5.81%	2.37%	NA
Indica III	913	82.60%	17.20%	0.11%	0.11%	NA
Indica Intermediate	786	86.30%	12.20%	1.27%	0.25%	NA
Temperate Japonica	767	79.10%	19.80%	1.04%	0.00%	NA
Tropical Japonica	504	80.20%	19.80%	0.00%	0.00%	NA
Japonica Intermediate	241	79.30%	19.50%	1.24%	0.00%	NA
VI/Aromatic	96	47.90%	51.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224574434	T -> DEL	N	N	silent_mutation	Average:67.442; most accessible tissue: Minghui63 flower, score: 84.9	N	N	N	N
vg0224574434	T -> C	LOC_Os02g40520.1	upstream_gene_variant ; 3543.0bp to feature; MODIFIER	silent_mutation	Average:67.442; most accessible tissue: Minghui63 flower, score: 84.9	N	N	N	N
vg0224574434	T -> C	LOC_Os02g40510.1	downstream_gene_variant ; 1874.0bp to feature; MODIFIER	silent_mutation	Average:67.442; most accessible tissue: Minghui63 flower, score: 84.9	N	N	N	N
vg0224574434	T -> C	LOC_Os02g40514.1	intron_variant ; MODIFIER	silent_mutation	Average:67.442; most accessible tissue: Minghui63 flower, score: 84.9	N	N	N	N
vg0224574434	T -> C	LOC_Os02g40514.2	intron_variant ; MODIFIER	silent_mutation	Average:67.442; most accessible tissue: Minghui63 flower, score: 84.9	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224574434	1.60E-06	NA	mr1795	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224574434	9.62E-07	1.49E-06	mr1795	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224574434	3.97E-06	NA	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251