\
| Variant ID: vg0224555817 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24555817 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATATATATATATATATATATTTGTGTGAAAAAATTGAATAAGACAAATGGTACAATATTTGATAAAAAACTAATAGTGTCATATATTAAAGAAACGGAT[G/A]
TAGTATCATAGTGCTACCAGAGTACAAATTTGCAACGTATGTCTAGAAAAAGTGTCCTAATGCATCAATATTCAGCCCAAAAAGGGCTTATGATGTTAGG
CCTAACATCATAAGCCCTTTTTGGGCTGAATATTGATGCATTAGGACACTTTTTCTAGACATACGTTGCAAATTTGTACTCTGGTAGCACTATGATACTA[C/T]
ATCCGTTTCTTTAATATATGACACTATTAGTTTTTTATCAAATATTGTACCATTTGTCTTATTCAATTTTTTCACACAAATATATATATATATATATATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 0.10% | 0.53% | 5.67% | NA |
| All Indica | 2759 | 97.40% | 0.00% | 0.62% | 2.03% | NA |
| All Japonica | 1512 | 86.70% | 0.30% | 0.53% | 12.50% | NA |
| Aus | 269 | 98.10% | 0.00% | 0.00% | 1.86% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.67% | 0.17% | NA |
| Indica II | 465 | 98.50% | 0.00% | 0.00% | 1.51% | NA |
| Indica III | 913 | 96.50% | 0.00% | 0.66% | 2.85% | NA |
| Indica Intermediate | 786 | 96.30% | 0.00% | 0.89% | 2.80% | NA |
| Temperate Japonica | 767 | 81.10% | 0.10% | 0.78% | 17.99% | NA |
| Tropical Japonica | 504 | 94.60% | 0.40% | 0.20% | 4.76% | NA |
| Japonica Intermediate | 241 | 88.00% | 0.40% | 0.41% | 11.20% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 88.90% | 1.10% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224555817 | G -> A | LOC_Os02g40490.1 | upstream_gene_variant ; 4359.0bp to feature; MODIFIER | silent_mutation | Average:56.809; most accessible tissue: Minghui63 root, score: 74.1 | N | N | N | N |
| vg0224555817 | G -> A | LOC_Os02g40480-LOC_Os02g40490 | intergenic_region ; MODIFIER | silent_mutation | Average:56.809; most accessible tissue: Minghui63 root, score: 74.1 | N | N | N | N |
| vg0224555817 | G -> DEL | N | N | silent_mutation | Average:56.809; most accessible tissue: Minghui63 root, score: 74.1 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224555817 | NA | 1.27E-06 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224555817 | NA | 2.15E-08 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224555817 | NA | 3.71E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224555817 | 1.26E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224555817 | 1.51E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224555817 | NA | 2.89E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224555817 | 1.97E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224555817 | 5.42E-07 | 9.97E-07 | mr1986_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |