\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224529885:

Variant ID: vg0224529885 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24529885
Reference Allele: CAlternative Allele: A,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, A: 0.11, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCCACTCGTAATAATACCCATTTCTTACGCTCGAATCACCCTCCCCGAGCAGCGCGATCTCGGACAGCGACGCCGAAGTCGGAGTGCTCCGCCGCCGC[C/A,G]
GCGGCTGGCCGTTCCCTTTCCTCGACCTGTGTTCGGAGACCTGCCTTGAAGCTATAAAATCATTACATTCTAGCTACTAATCCTACAGAAAAGAAGAGCT

Reverse complement sequence

AGCTCTTCTTTTCTGTAGGATTAGTAGCTAGAATGTAATGATTTTATAGCTTCAAGGCAGGTCTCCGAACACAGGTCGAGGAAAGGGAACGGCCAGCCGC[G/T,C]
GCGGCGGCGGAGCACTCCGACTTCGGCGTCGCTGTCCGAGATCGCGCTGCTCGGGGAGGGTGATTCGAGCGTAAGAAATGGGTATTATTACGAGTGGGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.20% 0.78% 0.19% G: 0.02%
All Indica  2759 61.80% 37.10% 0.83% 0.29% NA
All Japonica  1512 49.10% 50.10% 0.66% 0.07% NA
Aus  269 77.70% 21.60% 0.74% 0.00% NA
Indica I  595 82.40% 16.30% 0.67% 0.67% NA
Indica II  465 47.10% 52.30% 0.65% 0.00% NA
Indica III  913 61.70% 38.00% 0.11% 0.22% NA
Indica Intermediate  786 55.10% 42.70% 1.91% 0.25% NA
Temperate Japonica  767 42.40% 56.60% 1.04% 0.00% NA
Tropical Japonica  504 63.50% 36.10% 0.20% 0.20% NA
Japonica Intermediate  241 40.70% 58.90% 0.41% 0.00% NA
VI/Aromatic  96 71.90% 27.10% 1.04% 0.00% NA
Intermediate  90 56.70% 41.10% 1.11% 0.00% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224529885 C -> A LOC_Os02g40454.1 missense_variant ; p.Arg193Leu; MODERATE nonsynonymous_codon ; R193L Average:64.894; most accessible tissue: Minghui63 flag leaf, score: 78.782 benign 1.207 TOLERATED 0.18
vg0224529885 C -> A LOC_Os02g40454.2 missense_variant ; p.Gly197Cys; MODERATE nonsynonymous_codon ; G197C Average:64.894; most accessible tissue: Minghui63 flag leaf, score: 78.782 unknown unknown TOLERATED 0.14
vg0224529885 C -> G LOC_Os02g40454.1 missense_variant ; p.Arg193Pro; MODERATE nonsynonymous_codon ; R193P Average:64.894; most accessible tissue: Minghui63 flag leaf, score: 78.782 benign -0.263 TOLERATED 0.21
vg0224529885 C -> G LOC_Os02g40454.2 missense_variant ; p.Gly197Arg; MODERATE nonsynonymous_codon ; G197R Average:64.894; most accessible tissue: Minghui63 flag leaf, score: 78.782 unknown unknown TOLERATED 0.84
vg0224529885 C -> DEL LOC_Os02g40454.1 N frameshift_variant Average:64.894; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0224529885 C -> DEL LOC_Os02g40454.2 N frameshift_variant Average:64.894; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224529885 NA 4.17E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 2.08E-10 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 6.52E-09 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.16E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 3.19E-08 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 8.78E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 3.41E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.30E-08 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 2.51E-08 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 2.71E-06 2.29E-09 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.05E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 4.76E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 5.68E-06 7.14E-07 mr1146 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 6.80E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 2.08E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 5.23E-07 8.57E-12 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 4.64E-09 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.13E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.81E-08 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 2.15E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 6.06E-09 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 9.44E-09 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.13E-07 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 8.51E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.91E-07 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.48E-06 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.59E-06 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 8.28E-06 1.24E-11 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 3.61E-08 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 2.09E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 1.80E-06 4.58E-12 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 5.38E-06 2.31E-09 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.50E-10 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 3.03E-12 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 2.33E-08 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 5.34E-12 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 6.90E-11 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 3.49E-09 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 5.82E-06 6.93E-11 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 6.27E-06 2.45E-11 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 3.98E-07 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 6.89E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.01E-11 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 9.55E-07 4.43E-08 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 5.42E-07 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 7.40E-06 1.65E-13 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 4.59E-08 1.83E-15 mr1150_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 2.94E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 6.50E-09 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 6.29E-13 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 3.80E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 1.22E-06 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.04E-08 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 2.08E-12 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 7.84E-06 3.14E-09 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 NA 1.31E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 5.73E-06 3.57E-08 mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 3.81E-07 NA mr1962_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529885 3.12E-06 1.46E-12 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251