Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224529129:

Variant ID: vg0224529129 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24529129
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATTCAACTTCTACAAATTATAACAAAAATAACAAACAAAACTCAAATTACTGTATGTATATTTACAATTAAATTTGTTATTTTTGTTACAACTTATA[G/A]
AAGTTGAATTTGAACTTACATGTTTGTGGAGTGATATATTACATATTGATCTCTCTTGTCAATTTTTTTGAAAATTTTCCGTAACCATCTAGCTGACATG

Reverse complement sequence

CATGTCAGCTAGATGGTTACGGAAAATTTTCAAAAAAATTGACAAGAGAGATCAATATGTAATATATCACTCCACAAACATGTAAGTTCAAATTCAACTT[C/T]
TATAAGTTGTAACAAAAATAACAAATTTAATTGTAAATATACATACAGTAATTTGAGTTTTGTTTGTTATTTTTGTTATAATTTGTAGAAGTTGAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	13.30%	0.00%	0.00%	NA
All Indica	2759	91.60%	8.40%	0.00%	0.00%	NA
All Japonica	1512	76.80%	23.20%	0.00%	0.00%	NA
Aus	269	91.10%	8.90%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	82.40%	17.60%	0.00%	0.00%	NA
Indica III	913	94.60%	5.40%	0.00%	0.00%	NA
Indica Intermediate	786	87.80%	12.20%	0.00%	0.00%	NA
Temperate Japonica	767	70.40%	29.60%	0.00%	0.00%	NA
Tropical Japonica	504	89.30%	10.70%	0.00%	0.00%	NA
Japonica Intermediate	241	71.00%	29.00%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224529129	G -> A	LOC_Os02g40450.1	downstream_gene_variant ; 1896.0bp to feature; MODIFIER	silent_mutation	Average:34.148; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N
vg0224529129	G -> A	LOC_Os02g40460.1	downstream_gene_variant ; 2162.0bp to feature; MODIFIER	silent_mutation	Average:34.148; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N
vg0224529129	G -> A	LOC_Os02g40454.1	intron_variant ; MODIFIER	silent_mutation	Average:34.148; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N
vg0224529129	G -> A	LOC_Os02g40454.2	intron_variant ; MODIFIER	silent_mutation	Average:34.148; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224529129	NA	4.99E-10	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	4.93E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	2.61E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	6.32E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	1.50E-07	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	9.68E-07	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	7.01E-06	4.93E-11	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	7.46E-10	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	2.76E-09	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	4.38E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	1.09E-09	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	6.90E-09	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	1.40E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	4.67E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	6.84E-08	5.58E-12	mr1946_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	6.84E-08	5.58E-12	mr1948_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129	NA	1.24E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251