\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224529129:

Variant ID: vg0224529129 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24529129
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTCAACTTCTACAAATTATAACAAAAATAACAAACAAAACTCAAATTACTGTATGTATATTTACAATTAAATTTGTTATTTTTGTTACAACTTATA[G/A]
AAGTTGAATTTGAACTTACATGTTTGTGGAGTGATATATTACATATTGATCTCTCTTGTCAATTTTTTTGAAAATTTTCCGTAACCATCTAGCTGACATG

Reverse complement sequence

CATGTCAGCTAGATGGTTACGGAAAATTTTCAAAAAAATTGACAAGAGAGATCAATATGTAATATATCACTCCACAAACATGTAAGTTCAAATTCAACTT[C/T]
TATAAGTTGTAACAAAAATAACAAATTTAATTGTAAATATACATACAGTAATTTGAGTTTTGTTTGTTATTTTTGTTATAATTTGTAGAAGTTGAATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 13.30% 0.00% 0.00% NA
All Indica  2759 91.60% 8.40% 0.00% 0.00% NA
All Japonica  1512 76.80% 23.20% 0.00% 0.00% NA
Aus  269 91.10% 8.90% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 82.40% 17.60% 0.00% 0.00% NA
Indica III  913 94.60% 5.40% 0.00% 0.00% NA
Indica Intermediate  786 87.80% 12.20% 0.00% 0.00% NA
Temperate Japonica  767 70.40% 29.60% 0.00% 0.00% NA
Tropical Japonica  504 89.30% 10.70% 0.00% 0.00% NA
Japonica Intermediate  241 71.00% 29.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224529129 G -> A LOC_Os02g40450.1 downstream_gene_variant ; 1896.0bp to feature; MODIFIER silent_mutation Average:34.148; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0224529129 G -> A LOC_Os02g40460.1 downstream_gene_variant ; 2162.0bp to feature; MODIFIER silent_mutation Average:34.148; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0224529129 G -> A LOC_Os02g40454.1 intron_variant ; MODIFIER silent_mutation Average:34.148; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0224529129 G -> A LOC_Os02g40454.2 intron_variant ; MODIFIER silent_mutation Average:34.148; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224529129 NA 4.99E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 4.93E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 2.61E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 6.32E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 1.50E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 9.68E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 7.01E-06 4.93E-11 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 7.46E-10 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 2.76E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 4.38E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 1.09E-09 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 6.90E-09 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 1.40E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 4.67E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 6.84E-08 5.58E-12 mr1946_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 6.84E-08 5.58E-12 mr1948_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224529129 NA 1.24E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251