Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224513696:

Variant ID: vg0224513696 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24513696
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGGTAATATATGAACCAGATTCGATATTGAAATCGAGGCGGATTCGGTAGAGAGATGGATTCGAAGAACAGAGCATGCATTGGCTACGAAGGCATCGG[C/T]
TGGAGTCTGCATCGACTGAGATGGATCGGACAGATAACATCCGACACAGCCGATAGAGGTGATGTAGCCGATTCCGATGATAATGGTTTCAAAGATGTTT

Reverse complement sequence

AAACATCTTTGAAACCATTATCATCGGAATCGGCTACATCACCTCTATCGGCTGTGTCGGATGTTATCTGTCCGATCCATCTCAGTCGATGCAGACTCCA[G/A]
CCGATGCCTTCGTAGCCAATGCATGCTCTGTTCTTCGAATCCATCTCTCTACCGAATCCGCCTCGATTTCAATATCGAATCTGGTTCATATATTACCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.00%	6.20%	0.74%	0.00%	NA
All Indica	2759	92.60%	7.20%	0.14%	0.00%	NA
All Japonica	1512	97.70%	0.30%	2.05%	0.00%	NA
Aus	269	71.70%	28.30%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	83.00%	16.60%	0.43%	0.00%	NA
Indica III	913	95.40%	4.50%	0.11%	0.00%	NA
Indica Intermediate	786	89.60%	10.30%	0.13%	0.00%	NA
Temperate Japonica	767	96.20%	0.10%	3.65%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.40%	1.24%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224513696	C -> T	LOC_Os02g40440.1	upstream_gene_variant ; 2678.0bp to feature; MODIFIER	silent_mutation	Average:25.866; most accessible tissue: Zhenshan97 young leaf, score: 35.2	N	N	N	N
vg0224513696	C -> T	LOC_Os02g40450.1	upstream_gene_variant ; 4531.0bp to feature; MODIFIER	silent_mutation	Average:25.866; most accessible tissue: Zhenshan97 young leaf, score: 35.2	N	N	N	N
vg0224513696	C -> T	LOC_Os02g40430-LOC_Os02g40440	intergenic_region ; MODIFIER	silent_mutation	Average:25.866; most accessible tissue: Zhenshan97 young leaf, score: 35.2	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224513696	NA	9.94E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	1.90E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	3.88E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	8.80E-06	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	7.05E-10	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	1.14E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	9.82E-09	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	7.41E-09	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	7.82E-06	mr1402_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	3.94E-06	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	4.50E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	NA	5.19E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224513696	3.68E-06	3.13E-06	mr1901_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251