\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224508619:

Variant ID: vg0224508619 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24508619
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATGTTTTACTATGTATAGATCTAATGTTGCAGTGAACGAAATATTCTATTGCAACAAAAAAACCCACATATTTTGGAAACCCCCTATTAAGAGAATTT[G/A]
GTTTATTTTTTGTTTCACCGAAAAATGTTTCACCTAATGTAATCACAATGTTTCACTATATATAGATATAATGTTGCAGTGAACTGAAATATTTTTTCGC

Reverse complement sequence

GCGAAAAAATATTTCAGTTCACTGCAACATTATATCTATATATAGTGAAACATTGTGATTACATTAGGTGAAACATTTTTCGGTGAAACAAAAAATAAAC[C/T]
AAATTCTCTTAATAGGGGGTTTCCAAAATATGTGGGTTTTTTTGTTGCAATAGAATATTTCGTTCACTGCAACATTAGATCTATACATAGTAAAACATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 0.40% 0.42% 4.44% NA
All Indica  2759 93.70% 0.50% 0.51% 5.29% NA
All Japonica  1512 96.80% 0.00% 0.13% 3.11% NA
Aus  269 92.20% 1.10% 1.49% 5.20% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 83.90% 1.90% 0.43% 13.76% NA
Indica III  913 96.50% 0.00% 0.55% 2.96% NA
Indica Intermediate  786 91.60% 0.60% 0.89% 6.87% NA
Temperate Japonica  767 98.20% 0.00% 0.00% 1.83% NA
Tropical Japonica  504 94.80% 0.00% 0.40% 4.76% NA
Japonica Intermediate  241 96.30% 0.00% 0.00% 3.73% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224508619 G -> A LOC_Os02g40430-LOC_Os02g40440 intergenic_region ; MODIFIER silent_mutation Average:40.416; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0224508619 G -> DEL N N silent_mutation Average:40.416; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224508619 NA 9.80E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 4.29E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 4.98E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 7.01E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 2.61E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 6.92E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 7.91E-06 7.90E-06 mr1863 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 2.41E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 7.01E-07 6.76E-12 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 1.09E-06 6.70E-11 mr1075_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 1.29E-10 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 2.18E-06 2.08E-11 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 8.09E-07 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 7.64E-10 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 1.44E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 4.18E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 3.97E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508619 NA 3.89E-06 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251