\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224488705:

Variant ID: vg0224488705 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24488705
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTTGATTCATTGTTAAATATACTTTTATGTATACATATAGCTTTACATATTTCACAAAAGTTTTTTAATAAGACGAACGGTCAAACATGTTTAAAAAA[G/A,T]
CCAACGGCGTCAAACATTATTTAAAAAAGTCAAACAGCGTCAAACATTCATGGAAGGAAGGAGTAGTAAGCAAAACCATTCAAGGATCTGTTGAGCAAAT

Reverse complement sequence

ATTTGCTCAACAGATCCTTGAATGGTTTTGCTTACTACTCCTTCCTTCCATGAATGTTTGACGCTGTTTGACTTTTTTAAATAATGTTTGACGCCGTTGG[C/T,A]
TTTTTTAAACATGTTTGACCGTTCGTCTTATTAAAAAACTTTTGTGAAATATGTAAAGCTATATGTATACATAAAAGTATATTTAACAATGAATCAAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 9.90% 0.02% 0.00% T: 0.36%
All Indica  2759 89.50% 9.90% 0.00% 0.00% T: 0.62%
All Japonica  1512 89.50% 10.50% 0.00% 0.00% NA
Aus  269 90.00% 9.70% 0.37% 0.00% NA
Indica I  595 92.10% 7.20% 0.00% 0.00% T: 0.67%
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 83.70% 15.70% 0.00% 0.00% T: 0.66%
Indica Intermediate  786 88.80% 10.30% 0.00% 0.00% T: 0.89%
Temperate Japonica  767 89.20% 10.80% 0.00% 0.00% NA
Tropical Japonica  504 91.50% 8.50% 0.00% 0.00% NA
Japonica Intermediate  241 86.30% 13.70% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224488705 G -> A LOC_Os02g40420.1 upstream_gene_variant ; 1271.0bp to feature; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 90.335 N N N N
vg0224488705 G -> A LOC_Os02g40430.1 downstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 90.335 N N N N
vg0224488705 G -> A LOC_Os02g40420-LOC_Os02g40430 intergenic_region ; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 90.335 N N N N
vg0224488705 G -> T LOC_Os02g40420.1 upstream_gene_variant ; 1271.0bp to feature; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 90.335 N N N N
vg0224488705 G -> T LOC_Os02g40430.1 downstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 90.335 N N N N
vg0224488705 G -> T LOC_Os02g40420-LOC_Os02g40430 intergenic_region ; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 90.335 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224488705 NA 6.56E-06 mr1591_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224488705 2.50E-06 NA mr1594_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224488705 4.91E-06 2.19E-07 mr1594_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251