\
| Variant ID: vg0224480548 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24480548 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 268. )
CATGCCAAGCAGGCAAGGTACATCCGTACGCATCAGGAAATAAAGGCCATTTCCTAATCACTTTGTCAATTTTTTTGGCATAAACCTTTACATAAACCAA[G/A]
TGAATGATTATTTTTTGGCATTGCCAATTGTTTTGGCTTGGGTAAGTTTGGGTCTGTTTGGGGAAGCTTTTAGATTCTGAGAAGCAGCTGTTTGGTAGCC
GGCTACCAAACAGCTGCTTCTCAGAATCTAAAAGCTTCCCCAAACAGACCCAAACTTACCCAAGCCAAAACAATTGGCAATGCCAAAAAATAATCATTCA[C/T]
TTGGTTTATGTAAAGGTTTATGCCAAAAAAATTGACAAAGTGATTAGGAAATGGCCTTTATTTCCTGATGCGTACGGATGTACCTTGCCTGCTTGGCATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 15.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 91.70% | 8.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 71.00% | 28.70% | 0.26% | 0.00% | NA |
| Aus | 269 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.30% | 12.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.30% | 10.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 66.00% | 33.60% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 78.40% | 21.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224480548 | G -> A | LOC_Os02g40410.1 | upstream_gene_variant ; 3225.0bp to feature; MODIFIER | silent_mutation | Average:58.662; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0224480548 | G -> A | LOC_Os02g40410.2 | upstream_gene_variant ; 4895.0bp to feature; MODIFIER | silent_mutation | Average:58.662; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0224480548 | G -> A | LOC_Os02g40420.1 | downstream_gene_variant ; 2442.0bp to feature; MODIFIER | silent_mutation | Average:58.662; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0224480548 | G -> A | LOC_Os02g40410-LOC_Os02g40420 | intergenic_region ; MODIFIER | silent_mutation | Average:58.662; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224480548 | 1.90E-06 | NA | mr1180 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224480548 | NA | 1.35E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224480548 | 5.48E-06 | NA | mr1183 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224480548 | NA | 2.16E-07 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224480548 | 5.43E-06 | NA | mr1503 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224480548 | NA | 7.78E-08 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224480548 | 3.55E-06 | NA | mr1123_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224480548 | NA | 1.83E-07 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |