Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224477732:

Variant ID: vg0224477732 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24477732
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TTATTACTCCCTCCATCTACTTTCGATCTACTTTCGAATGTCATATTTATCTTGACACATAAATCAAAGATAAGTAATTCTATTTATCATCCATTTAAAC[A/C]
TGCTACTAGTTATTTCTCGTAAACAAGCGATTCATTAATATTTACATTTCTCGATGCCATGTAGCCAATCTTGTGTGGAAAAATGGAGAGTCACGCATCA

Reverse complement sequence

TGATGCGTGACTCTCCATTTTTCCACACAAGATTGGCTACATGGCATCGAGAAATGTAAATATTAATGAATCGCTTGTTTACGAGAAATAACTAGTAGCA[T/G]
GTTTAAATGGATGATAAATAGAATTACTTATCTTTGATTTATGTGTCAAGATAAATATGACATTCGAAAGTAGATCGAAAGTAGATGGAGGGAGTAATAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	14.80%	0.78%	0.13%	NA
All Indica	2759	90.90%	8.40%	0.65%	0.04%	NA
All Japonica	1512	73.50%	25.50%	0.73%	0.26%	NA
Aus	269	75.50%	23.00%	1.49%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	76.30%	21.70%	1.94%	0.00%	NA
Indica III	913	96.30%	3.50%	0.22%	0.00%	NA
Indica Intermediate	786	86.80%	12.20%	0.89%	0.13%	NA
Temperate Japonica	767	73.10%	25.80%	0.91%	0.13%	NA
Tropical Japonica	504	74.40%	24.40%	0.60%	0.60%	NA
Japonica Intermediate	241	72.60%	27.00%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	8.30%	1.04%	0.00%	NA
Intermediate	90	82.20%	13.30%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224477732	A -> DEL	N	N	silent_mutation	Average:55.055; most accessible tissue: Callus, score: 84.755	N	N	N	N
vg0224477732	A -> C	LOC_Os02g40410.1	upstream_gene_variant ; 409.0bp to feature; MODIFIER	silent_mutation	Average:55.055; most accessible tissue: Callus, score: 84.755	N	N	N	N
vg0224477732	A -> C	LOC_Os02g40410.2	upstream_gene_variant ; 2079.0bp to feature; MODIFIER	silent_mutation	Average:55.055; most accessible tissue: Callus, score: 84.755	N	N	N	N
vg0224477732	A -> C	LOC_Os02g40410-LOC_Os02g40420	intergenic_region ; MODIFIER	silent_mutation	Average:55.055; most accessible tissue: Callus, score: 84.755	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224477732	NA	3.33E-07	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224477732	NA	6.69E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224477732	NA	8.83E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224477732	NA	4.46E-07	mr1479_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224477732	NA	1.58E-06	mr1502_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224477732	NA	5.19E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224477732	3.40E-06	3.40E-06	mr1680_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224477732	NA	1.01E-07	mr1871_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224477732	NA	2.49E-07	mr1892_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251