RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0224471358:

Variant ID: vg0224471358 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24471358
Reference Allele: T	Alternative Allele: A,G
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTTGTAACGCACGGGTATTTTTGCTAGTTTATCAAAAGTTTAAAATGCTACTACAAGCTTCCAATCAGCTAGAAATACATACTCCCTCTGTCTCACAA[T/A,G]
GAAGCACCTCCTAACATTCCAATGTAAAATTAAAGGAGGATAAAAGACCAAAATACCCTTTATTGATAATAAATTAGTATTGGTGGGTAGGTGGCAAGGG

Reverse complement sequence

CCCTTGCCACCTACCCACCAATACTAATTTATTATCAATAAAGGGTATTTTGGTCTTTTATCCTCCTTTAATTTTACATTGGAATGTTAGGAGGTGCTTC[A/T,C]
TTGTGAGACAGAGGGAGTATGTATTTCTAGCTGATTGGAAGCTTGTAGTAGCATTTTAAACTTTTGATAAACTAGCAAAAATACCCGTGCGTTACAACGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	42.60%	0.36%	0.00%	G: 0.30%
All Indica	2759	65.90%	33.80%	0.22%	0.00%	G: 0.07%
All Japonica	1512	41.90%	57.70%	0.46%	0.00%	NA
Aus	269	51.30%	43.50%	0.74%	0.00%	G: 4.46%
Indica I	595	50.90%	48.90%	0.17%	0.00%	NA
Indica II	465	67.10%	32.70%	0.22%	0.00%	NA
Indica III	913	71.60%	28.30%	0.00%	0.00%	G: 0.11%
Indica Intermediate	786	69.80%	29.50%	0.51%	0.00%	G: 0.13%
Temperate Japonica	767	37.70%	61.80%	0.52%	0.00%	NA
Tropical Japonica	504	56.70%	42.90%	0.40%	0.00%	NA
Japonica Intermediate	241	24.10%	75.50%	0.41%	0.00%	NA
VI/Aromatic	96	42.70%	57.30%	0.00%	0.00%	NA
Intermediate	90	55.60%	42.20%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224471358	T -> A	LOC_Os02g40400.1	upstream_gene_variant ; 3643.0bp to feature; MODIFIER	silent_mutation	Average:30.481; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0224471358	T -> A	LOC_Os02g40410.1	downstream_gene_variant ; 186.0bp to feature; MODIFIER	silent_mutation	Average:30.481; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0224471358	T -> A	LOC_Os02g40410.2	downstream_gene_variant ; 187.0bp to feature; MODIFIER	silent_mutation	Average:30.481; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0224471358	T -> A	LOC_Os02g40400-LOC_Os02g40410	intergenic_region ; MODIFIER	silent_mutation	Average:30.481; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0224471358	T -> G	LOC_Os02g40400.1	upstream_gene_variant ; 3643.0bp to feature; MODIFIER	silent_mutation	Average:30.481; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0224471358	T -> G	LOC_Os02g40410.1	downstream_gene_variant ; 186.0bp to feature; MODIFIER	silent_mutation	Average:30.481; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0224471358	T -> G	LOC_Os02g40410.2	downstream_gene_variant ; 187.0bp to feature; MODIFIER	silent_mutation	Average:30.481; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0224471358	T -> G	LOC_Os02g40400-LOC_Os02g40410	intergenic_region ; MODIFIER	silent_mutation	Average:30.481; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Showing 1 to 8 of 8 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224471358	2.95E-06	NA	mr1582_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 1 of 1 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0224471358:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact