\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224459356:

Variant ID: vg0224459356 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24459356
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


TCCATAAGTCGCTTGAAAGTTGATATTCCACTCTTTAAGTTGTTTTGTTATAAATGTCAATCCACATACTCGGTTTGGTTACAAAAACTATCCCAATGCA[C/T]
ATGTGCTTAACCGAATCAATATGTTTTCGTATATTTGTGAAACATCAATGTGATCTGTACCAAAACTAAAAATACTTCTAGAAGTATAATTTTGACACTT

Reverse complement sequence

AAGTGTCAAAATTATACTTCTAGAAGTATTTTTAGTTTTGGTACAGATCACATTGATGTTTCACAAATATACGAAAACATATTGATTCGGTTAAGCACAT[G/A]
TGCATTGGGATAGTTTTTGTAACCAAACCGAGTATGTGGATTGACATTTATAACAAAACAACTTAAAGAGTGGAATATCAACTTTCAAGCGACTTATGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 34.50% 0.74% 18.60% NA
All Indica  2759 45.00% 39.30% 0.43% 15.30% NA
All Japonica  1512 44.50% 27.20% 1.26% 26.98% NA
Aus  269 68.40% 19.00% 0.74% 11.90% NA
Indica I  595 39.20% 24.20% 0.67% 35.97% NA
Indica II  465 67.70% 28.60% 0.00% 3.66% NA
Indica III  913 30.40% 55.30% 0.44% 13.80% NA
Indica Intermediate  786 52.80% 38.40% 0.51% 8.27% NA
Temperate Japonica  767 37.70% 27.00% 1.83% 33.51% NA
Tropical Japonica  504 56.90% 31.20% 0.60% 11.31% NA
Japonica Intermediate  241 40.20% 19.90% 0.83% 39.00% NA
VI/Aromatic  96 41.70% 54.20% 1.04% 3.12% NA
Intermediate  90 50.00% 33.30% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224459356 C -> T LOC_Os02g40390.1 upstream_gene_variant ; 1448.0bp to feature; MODIFIER silent_mutation Average:22.341; most accessible tissue: Callus, score: 49.293 N N N N
vg0224459356 C -> T LOC_Os02g40400.1 downstream_gene_variant ; 2892.0bp to feature; MODIFIER silent_mutation Average:22.341; most accessible tissue: Callus, score: 49.293 N N N N
vg0224459356 C -> T LOC_Os02g40390-LOC_Os02g40400 intergenic_region ; MODIFIER silent_mutation Average:22.341; most accessible tissue: Callus, score: 49.293 N N N N
vg0224459356 C -> DEL N N silent_mutation Average:22.341; most accessible tissue: Callus, score: 49.293 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224459356 NA 4.69E-06 mr1047_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224459356 3.14E-06 1.36E-06 mr1189_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251