\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224382271:

Variant ID: vg0224382271 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24382271
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, G: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTTTGGATCTAAGTTGAATGGCCCTTCAACCACAAGAGACCCCTCCCAAGATTCTGAAAGATCAGGGATGGGAAACTTCATTTGTCTGAGAATTTGCT[T/G]
CTCCCATGTCTCCTCCCTATCAGCTGCATAATAAGGGTTCCCGTCTTCATACCTAAACCCATCGCCGTATTTCATGAAAATGTTCCTTCCATTGCTGTAG

Reverse complement sequence

CTACAGCAATGGAAGGAACATTTTCATGAAATACGGCGATGGGTTTAGGTATGAAGACGGGAACCCTTATTATGCAGCTGATAGGGAGGAGACATGGGAG[A/C]
AGCAAATTCTCAGACAAATGAAGTTTCCCATCCCTGATCTTTCAGAATCTTGGGAGGGGTCTCTTGTGGTTGAAGGGCCATTCAACTTAGATCCAAACCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 7.60% 0.87% 0.78% NA
All Indica  2759 88.60% 10.60% 0.69% 0.07% NA
All Japonica  1512 96.10% 0.30% 1.32% 2.31% NA
Aus  269 80.30% 19.30% 0.37% 0.00% NA
Indica I  595 91.60% 7.40% 1.01% 0.00% NA
Indica II  465 75.30% 24.30% 0.43% 0.00% NA
Indica III  913 95.20% 4.20% 0.44% 0.22% NA
Indica Intermediate  786 86.60% 12.50% 0.89% 0.00% NA
Temperate Japonica  767 97.30% 0.00% 1.56% 1.17% NA
Tropical Japonica  504 95.60% 0.40% 1.19% 2.78% NA
Japonica Intermediate  241 93.40% 0.80% 0.83% 4.98% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224382271 T -> G LOC_Os02g40270.1 missense_variant ; p.Lys135Gln; MODERATE nonsynonymous_codon ; K135R Average:57.507; most accessible tissue: Callus, score: 79.631 benign 1.299 TOLERATED 0.39
vg0224382271 T -> G LOC_Os02g40270.1 missense_variant ; p.Lys135Gln; MODERATE nonsynonymous_codon ; K135Q Average:57.507; most accessible tissue: Callus, score: 79.631 possibly damaging 1.715 TOLERATED 0.14
vg0224382271 T -> DEL LOC_Os02g40270.1 N frameshift_variant Average:57.507; most accessible tissue: Callus, score: 79.631 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224382271 2.09E-06 NA mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 5.24E-06 3.22E-09 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 6.39E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 1.51E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 3.31E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 2.86E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 6.74E-06 1.65E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 1.62E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 4.16E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 9.06E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 4.18E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 3.82E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 8.65E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 2.64E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 7.41E-09 NA mr1072_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 6.58E-09 9.56E-13 mr1072_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 2.61E-08 NA mr1075_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 3.79E-09 8.38E-13 mr1075_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 6.89E-07 NA mr1077_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 2.50E-07 5.23E-12 mr1077_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 1.20E-06 NA mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 6.89E-08 1.30E-10 mr1124_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 1.47E-08 NA mr1149_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 3.29E-09 6.70E-13 mr1149_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 1.11E-07 NA mr1183_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 5.95E-08 5.45E-08 mr1183_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 6.13E-07 NA mr1441_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 4.99E-07 1.48E-11 mr1441_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 6.05E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 5.16E-06 NA mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 3.02E-08 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 7.03E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 8.08E-06 NA mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 2.61E-10 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 4.36E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382271 NA 4.36E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251