Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224357857:

Variant ID: vg0224357857 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24357857
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTACTGGACATAGGCTAGCTCAAATGTCACAATAAGTGAATTCCCGAGAAGACTCGCGCGTCTATTTGGCTTCTGAGCAGTCCTCAATGATTTGTCCAT[T/A]
ACTCCTTATTGGGAAGTCGAAATGACGAGCCGTTTGTTGGAGGTGAAACTAGACTTAATTATCTTTCCAACCATATATATTAAGCATGGAGAAAGTTGAC

Reverse complement sequence

GTCAACTTTCTCCATGCTTAATATATATGGTTGGAAAGATAATTAAGTCTAGTTTCACCTCCAACAAACGGCTCGTCATTTCGACTTCCCAATAAGGAGT[A/T]
ATGGACAAATCATTGAGGACTGCTCAGAAGCCAAATAGACGCGCGAGTCTTCTCGGGAATTCACTTATTGTGACATTTGAGCTAGCCTATGTCCAGTAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	1.20%	2.67%	8.57%	NA
All Indica	2759	98.40%	0.20%	0.91%	0.51%	NA
All Japonica	1512	66.10%	2.60%	6.02%	25.20%	NA
Aus	269	95.50%	1.50%	1.12%	1.86%	NA
Indica I	595	98.30%	0.30%	1.34%	0.00%	NA
Indica II	465	97.40%	0.00%	1.29%	1.29%	NA
Indica III	913	99.30%	0.30%	0.11%	0.22%	NA
Indica Intermediate	786	97.80%	0.10%	1.27%	0.76%	NA
Temperate Japonica	767	44.70%	5.00%	10.43%	39.90%	NA
Tropical Japonica	504	94.60%	0.20%	1.19%	3.97%	NA
Japonica Intermediate	241	74.70%	0.40%	2.07%	22.82%	NA
VI/Aromatic	96	88.50%	7.30%	3.12%	1.04%	NA
Intermediate	90	88.90%	2.20%	4.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224357857	T -> A	LOC_Os02g40250.1	upstream_gene_variant ; 3237.0bp to feature; MODIFIER	silent_mutation	Average:27.437; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N
vg0224357857	T -> A	LOC_Os02g40240.1	downstream_gene_variant ; 3163.0bp to feature; MODIFIER	silent_mutation	Average:27.437; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N
vg0224357857	T -> A	LOC_Os02g40240.2	downstream_gene_variant ; 3163.0bp to feature; MODIFIER	silent_mutation	Average:27.437; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N
vg0224357857	T -> A	LOC_Os02g40240-LOC_Os02g40250	intergenic_region ; MODIFIER	silent_mutation	Average:27.437; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N
vg0224357857	T -> DEL	N	N	silent_mutation	Average:27.437; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224357857	2.61E-07	2.61E-07	mr1067_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251