\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224343689:

Variant ID: vg0224343689 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24343689
Reference Allele: TAlternative Allele: C,TA
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCTTTCTTATGTCACTCATCAGGATAGCATTAGCATACCACCCACCCTGTTTCCTGGGTGATGTCGGTGATCTATCTCGGTATGATTCCCAGTGACCAC[T/C,TA]
GGCCAGTAGCCCAGTAGTAGTTGGCAAGACCCCCTTTCGTGCTCCGCATAACCGAGCTGTACTTCTGGATGTTCTCCAGCACGGGAACGCACGGTCACCG

Reverse complement sequence

CGGTGACCGTGCGTTCCCGTGCTGGAGAACATCCAGAAGTACAGCTCGGTTATGCGGAGCACGAAAGGGGGTCTTGCCAACTACTACTGGGCTACTGGCC[A/G,TA]
GTGGTCACTGGGAATCATACCGAGATAGATCACCGACATCACCCAGGAAACAGGGTGGGTGGTATGCTAATGCTATCCTGATGAGTGACATAAGAAAGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 11.30% 1.06% 37.28% TA: 0.04%
All Indica  2759 47.50% 10.00% 1.27% 41.17% TA: 0.07%
All Japonica  1512 58.20% 11.60% 0.46% 29.70% NA
Aus  269 36.10% 22.70% 2.60% 38.66% NA
Indica I  595 62.70% 3.50% 1.18% 32.61% NA
Indica II  465 44.90% 9.90% 1.29% 43.87% NA
Indica III  913 34.90% 15.10% 1.64% 48.30% NA
Indica Intermediate  786 52.00% 9.00% 0.89% 37.79% TA: 0.25%
Temperate Japonica  767 74.80% 5.30% 0.26% 19.56% NA
Tropical Japonica  504 37.30% 22.60% 0.40% 39.68% NA
Japonica Intermediate  241 49.00% 8.70% 1.24% 41.08% NA
VI/Aromatic  96 52.10% 5.20% 1.04% 41.67% NA
Intermediate  90 44.40% 18.90% 0.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224343689 T -> TA LOC_Os02g40230.1 upstream_gene_variant ; 4707.0bp to feature; MODIFIER silent_mutation Average:95.691; most accessible tissue: Zhenshan97 flower, score: 98.458 N N N N
vg0224343689 T -> TA LOC_Os02g40230-LOC_Os02g40240 intergenic_region ; MODIFIER silent_mutation Average:95.691; most accessible tissue: Zhenshan97 flower, score: 98.458 N N N N
vg0224343689 T -> DEL N N silent_mutation Average:95.691; most accessible tissue: Zhenshan97 flower, score: 98.458 N N N N
vg0224343689 T -> C LOC_Os02g40230.1 upstream_gene_variant ; 4706.0bp to feature; MODIFIER silent_mutation Average:95.691; most accessible tissue: Zhenshan97 flower, score: 98.458 N N N N
vg0224343689 T -> C LOC_Os02g40230-LOC_Os02g40240 intergenic_region ; MODIFIER silent_mutation Average:95.691; most accessible tissue: Zhenshan97 flower, score: 98.458 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224343689 T C -0.06 -0.2 -0.1 -0.08 -0.11 -0.06
vg0224343689 T TA -0.2 -0.26 -0.15 0.04 -0.09 -0.18

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224343689 NA 1.03E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224343689 2.92E-06 2.92E-06 mr1929 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224343689 NA 3.07E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251