\
| Variant ID: vg0224323881 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24323881 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCATTGCTCAACTGTCCACGAGTTCAGCATCGATCTGCAATCACTGCTAGATTTCAAGAAAGGCATCACGGAAAGATCCAAGCGGAGCCTTAAGTTCTTG[G/A]
AACACTAGCACTCACTTCTGTTGGTGGAAAGGTGTCATGTGCACCACTGCACGGCCGTTTCGCGTCTCAACGCTGAATCTCTCCGCCCAAAGCTTGGCAG
CTGCCAAGCTTTGGGCGGAGAGATTCAGCGTTGAGACGCGAAACGGCCGTGCAGTGGTGCACATGACACCTTTCCACCAACAGAAGTGAGTGCTAGTGTT[C/T]
CAAGAACTTAAGGCTCCGCTTGGATCTTTCCGTGATGCCTTTCTTGAAATCTAGCAGTGATTGCAGATCGATGCTGAACTCGTGGACAGTTGAGCAATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.30% | 5.10% | 4.87% | 31.80% | NA |
| All Indica | 2759 | 62.30% | 3.20% | 2.79% | 31.75% | NA |
| All Japonica | 1512 | 50.30% | 7.50% | 8.53% | 33.66% | NA |
| Aus | 269 | 64.70% | 2.60% | 5.95% | 26.77% | NA |
| Indica I | 595 | 74.10% | 0.50% | 0.67% | 24.71% | NA |
| Indica II | 465 | 60.90% | 4.10% | 1.51% | 33.55% | NA |
| Indica III | 913 | 58.30% | 3.10% | 4.05% | 34.61% | NA |
| Indica Intermediate | 786 | 58.90% | 4.70% | 3.69% | 32.70% | NA |
| Temperate Japonica | 767 | 38.90% | 12.40% | 3.26% | 45.50% | NA |
| Tropical Japonica | 504 | 72.40% | 0.00% | 14.68% | 12.90% | NA |
| Japonica Intermediate | 241 | 40.20% | 7.90% | 12.45% | 39.42% | NA |
| VI/Aromatic | 96 | 41.70% | 29.20% | 3.12% | 26.04% | NA |
| Intermediate | 90 | 67.80% | 3.30% | 5.56% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224323881 | G -> A | LOC_Os02g40190.1 | stop_gained ; p.Trp102*; HIGH | stop_gained | Average:45.1; most accessible tissue: Callus, score: 62.86 | N | N | N | N |
| vg0224323881 | G -> DEL | LOC_Os02g40190.1 | N | frameshift_variant | Average:45.1; most accessible tissue: Callus, score: 62.86 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224323881 | NA | 1.39E-06 | mr1952 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323881 | 1.73E-08 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323881 | 6.79E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323881 | 1.43E-06 | 5.40E-07 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323881 | 2.71E-06 | NA | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323881 | NA | 9.60E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323881 | NA | 2.27E-08 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323881 | 3.80E-06 | 2.65E-07 | mr1748_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323881 | 4.38E-07 | 5.69E-06 | mr1961_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |