Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224315896:

Variant ID: vg0224315896 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24315896
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCAACATCAGTGGCTCAACGCTTCCTGATAACAGCACAGATATGCTCTCTCTTCTTGGTTTCAAGGAAGCCATCACCAACGATCCGTCAGGAGTCTTGA[G/A]
CAACTGGAACACAAGCATCCACCTCTGCAGTTGGAACGGCGTCTGGTGCAGCCCCAAGCACCCCGGGCGAGTCACGGCGCTCAACCTCGCCGGCCAAGGT

Reverse complement sequence

ACCTTGGCCGGCGAGGTTGAGCGCCGTGACTCGCCCGGGGTGCTTGGGGCTGCACCAGACGCCGTTCCAACTGCAGAGGTGGATGCTTGTGTTCCAGTTG[C/T]
TCAAGACTCCTGACGGATCGTTGGTGATGGCTTCCTTGAAACCAAGAAGAGAGAGCATATCTGTGCTGTTATCAGGAAGCGTTGAGCCACTGATGTTGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.00%	5.40%	2.24%	21.35%	NA
All Indica	2759	76.50%	2.10%	1.05%	20.30%	NA
All Japonica	1512	61.80%	10.20%	4.50%	23.54%	NA
Aus	269	69.90%	11.50%	2.60%	15.99%	NA
Indica I	595	92.80%	0.30%	0.50%	6.39%	NA
Indica II	465	77.00%	5.80%	1.08%	16.13%	NA
Indica III	913	66.80%	1.20%	1.20%	30.78%	NA
Indica Intermediate	786	75.20%	2.40%	1.27%	21.12%	NA
Temperate Japonica	767	55.40%	13.30%	6.52%	24.77%	NA
Tropical Japonica	504	72.80%	2.00%	1.98%	23.21%	NA
Japonica Intermediate	241	58.90%	17.40%	3.32%	20.33%	NA
VI/Aromatic	96	56.20%	1.00%	0.00%	42.71%	NA
Intermediate	90	76.70%	11.10%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224315896	G -> A	LOC_Os02g40180.1	missense_variant ; p.Ser46Asn; MODERATE	nonsynonymous_codon ; S46N	Average:72.361; most accessible tissue: Zhenshan97 flower, score: 88.675	benign	0.705	TOLERATED	0.15
vg0224315896	G -> DEL	LOC_Os02g40180.1	N	frameshift_variant	Average:72.361; most accessible tissue: Zhenshan97 flower, score: 88.675	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0224315896	G	A	-0.01	-0.01	-0.01	-0.03	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224315896	6.16E-07	6.16E-07	mr1015	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224315896	NA	6.91E-06	mr1154	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224315896	2.58E-06	2.58E-06	mr1935	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251