\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224294117:

Variant ID: vg0224294117 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24294117
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAATGTTCTTAAACAATGCATTCGTTGGGAAAATTCCTCCTTTGGGAAAGCTTTCCAACCTAAATTTCTTAGACCTAGGGAGTAACAGGCTTGAAGCA[A/G]
GTGACAGTGATAGCTGGGAATTCTTACATGCACTAGGGAACTGTAGTTATCTACAAGATTTCTCACTATCACAAAATCAGCTAGAAGGACATATACCAGA

Reverse complement sequence

TCTGGTATATGTCCTTCTAGCTGATTTTGTGATAGTGAGAAATCTTGTAGATAACTACAGTTCCCTAGTGCATGTAAGAATTCCCAGCTATCACTGTCAC[T/C]
TGCTTCAAGCCTGTTACTCCCTAGGTCTAAGAAATTTAGGTTGGAAAGCTTTCCCAAAGGAGGAATTTTCCCAACGAATGCATTGTTTAAGAACATTATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 6.70% 0.70% 30.94% NA
All Indica  2759 66.90% 10.30% 0.51% 22.29% NA
All Japonica  1512 54.40% 0.30% 1.06% 44.18% NA
Aus  269 45.70% 8.20% 1.12% 44.98% NA
Indica I  595 87.40% 1.00% 0.00% 11.60% NA
Indica II  465 52.50% 17.40% 0.22% 29.89% NA
Indica III  913 64.10% 10.50% 0.88% 24.53% NA
Indica Intermediate  786 63.20% 12.80% 0.64% 23.28% NA
Temperate Japonica  767 45.50% 0.30% 1.96% 52.28% NA
Tropical Japonica  504 70.20% 0.40% 0.20% 29.17% NA
Japonica Intermediate  241 49.80% 0.40% 0.00% 49.79% NA
VI/Aromatic  96 66.70% 0.00% 0.00% 33.33% NA
Intermediate  90 64.40% 6.70% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224294117 A -> G LOC_Os02g40120.1 upstream_gene_variant ; 4476.0bp to feature; MODIFIER silent_mutation Average:57.191; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N
vg0224294117 A -> G LOC_Os02g40130.1 downstream_gene_variant ; 158.0bp to feature; MODIFIER silent_mutation Average:57.191; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N
vg0224294117 A -> G LOC_Os02g40130-LOC_Os02g40140 intergenic_region ; MODIFIER silent_mutation Average:57.191; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N
vg0224294117 A -> DEL N N silent_mutation Average:57.191; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224294117 2.06E-06 NA mr1069 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 1.60E-06 5.66E-10 mr1069 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 4.14E-10 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 4.46E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 1.37E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 1.53E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 2.82E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 3.13E-06 1.31E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 1.72E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 8.79E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 6.32E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 1.41E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 4.26E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 2.54E-06 NA mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 5.99E-06 9.43E-10 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 2.87E-06 NA mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 7.14E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 3.52E-07 NA mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 2.90E-07 1.91E-10 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 4.11E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 2.38E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 4.40E-06 NA mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 7.08E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 1.10E-07 NA mr1861 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 1.63E-08 5.85E-12 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 6.17E-06 NA mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 7.18E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 1.69E-06 NA mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 3.04E-12 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 1.75E-10 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 9.95E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 6.00E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 1.56E-06 9.17E-12 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 5.11E-09 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 7.83E-09 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224294117 NA 1.41E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251