\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224293976:

Variant ID: vg0224293976 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24293976
Reference Allele: CAAlternative Allele: GA,C
Primary Allele: CASecondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGGTTTGGAGTACAATATGCTAAGCAAAGCATTGCCACCTAACATTGGTGATGCCCTCTCCAATCTCGAAGTACTTGGGTAACAATATGTTTGAAGGT[CA/GA,C]
AATTCCAGCTTCTTTAGGTAATGCTTCAGGGCTACAAATAATAATGTTCTTAAACAATGCATTCGTTGGGAAAATTCCTCCTTTGGGAAAGCTTTCCAAC

Reverse complement sequence

GTTGGAAAGCTTTCCCAAAGGAGGAATTTTCCCAACGAATGCATTGTTTAAGAACATTATTATTTGTAGCCCTGAAGCATTACCTAAAGAAGCTGGAATT[TG/TC,G]
ACCTTCAAACATATTGTTACCCAAGTACTTCGAGATTGGAGAGGGCATCACCAATGTTAGGTGGCAATGCTTTGCTTAGCATATTGTACTCCAAACCTAA

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 6.70% 0.87% 25.90% NA
All Indica  2759 72.90% 10.30% 0.33% 16.46% NA
All Japonica  1512 59.30% 0.30% 0.99% 39.42% NA
Aus  269 41.60% 7.40% 6.32% 44.61% NA
Indica I  595 93.90% 1.00% 0.00% 5.04% NA
Indica II  465 52.90% 17.40% 0.43% 29.25% NA
Indica III  913 72.10% 10.50% 0.44% 16.98% NA
Indica Intermediate  786 69.70% 13.00% 0.38% 16.92% NA
Temperate Japonica  767 50.60% 0.30% 1.56% 47.59% NA
Tropical Japonica  504 76.00% 0.40% 0.60% 23.02% NA
Japonica Intermediate  241 51.90% 0.40% 0.00% 47.72% NA
VI/Aromatic  96 72.90% 0.00% 0.00% 27.08% NA
Intermediate  90 62.20% 6.70% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224293976 CA -> DEL N N silent_mutation Average:53.517; most accessible tissue: Callus, score: 86.393 N N N N
vg0224293976 CA -> GA LOC_Os02g40120.1 upstream_gene_variant ; 4335.0bp to feature; MODIFIER silent_mutation Average:53.517; most accessible tissue: Callus, score: 86.393 N N N N
vg0224293976 CA -> GA LOC_Os02g40130.1 downstream_gene_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:53.517; most accessible tissue: Callus, score: 86.393 N N N N
vg0224293976 CA -> GA LOC_Os02g40130-LOC_Os02g40140 intergenic_region ; MODIFIER silent_mutation Average:53.517; most accessible tissue: Callus, score: 86.393 N N N N
vg0224293976 CA -> C LOC_Os02g40120.1 upstream_gene_variant ; 4336.0bp to feature; MODIFIER N Average:53.517; most accessible tissue: Callus, score: 86.393 N N N N
vg0224293976 CA -> C LOC_Os02g40130.1 downstream_gene_variant ; 18.0bp to feature; MODIFIER N Average:53.517; most accessible tissue: Callus, score: 86.393 N N N N
vg0224293976 CA -> C LOC_Os02g40130-LOC_Os02g40140 intergenic_region ; MODIFIER N Average:53.517; most accessible tissue: Callus, score: 86.393 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224293976 6.38E-06 NA mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 7.35E-06 1.78E-09 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 8.86E-06 NA mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 6.07E-06 3.54E-10 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 4.21E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 3.94E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 3.92E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 4.77E-06 1.22E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 1.73E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 9.72E-06 NA mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 6.93E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 7.39E-06 3.31E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 4.72E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 2.01E-06 NA mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 4.79E-06 2.00E-09 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 1.74E-07 NA mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 1.48E-07 1.17E-10 mr1202 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 4.21E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 6.32E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 5.23E-06 NA mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 9.39E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 1.30E-07 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 3.02E-08 5.64E-12 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 8.32E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 2.15E-06 NA mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 5.56E-12 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 2.08E-10 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 4.25E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 9.31E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 1.20E-11 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 1.10E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 2.57E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976 NA 4.23E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251