Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224293976:

Variant ID: vg0224293976 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 24293976
Reference Allele: CA	Alternative Allele: GA,C
Primary Allele: CA	Secondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGGTTTGGAGTACAATATGCTAAGCAAAGCATTGCCACCTAACATTGGTGATGCCCTCTCCAATCTCGAAGTACTTGGGTAACAATATGTTTGAAGGT[CA/GA,C]
AATTCCAGCTTCTTTAGGTAATGCTTCAGGGCTACAAATAATAATGTTCTTAAACAATGCATTCGTTGGGAAAATTCCTCCTTTGGGAAAGCTTTCCAAC

Reverse complement sequence

GTTGGAAAGCTTTCCCAAAGGAGGAATTTTCCCAACGAATGCATTGTTTAAGAACATTATTATTTGTAGCCCTGAAGCATTACCTAAAGAAGCTGGAATT[TG/TC,G]
ACCTTCAAACATATTGTTACCCAAGTACTTCGAGATTGGAGAGGGCATCACCAATGTTAGGTGGCAATGCTTTGCTTAGCATATTGTACTCCAAACCTAA

Allele Frequencies:

Populations	Population Size	Frequency of CA(primary allele)	Frequency of GA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	6.70%	0.87%	25.90%	NA
All Indica	2759	72.90%	10.30%	0.33%	16.46%	NA
All Japonica	1512	59.30%	0.30%	0.99%	39.42%	NA
Aus	269	41.60%	7.40%	6.32%	44.61%	NA
Indica I	595	93.90%	1.00%	0.00%	5.04%	NA
Indica II	465	52.90%	17.40%	0.43%	29.25%	NA
Indica III	913	72.10%	10.50%	0.44%	16.98%	NA
Indica Intermediate	786	69.70%	13.00%	0.38%	16.92%	NA
Temperate Japonica	767	50.60%	0.30%	1.56%	47.59%	NA
Tropical Japonica	504	76.00%	0.40%	0.60%	23.02%	NA
Japonica Intermediate	241	51.90%	0.40%	0.00%	47.72%	NA
VI/Aromatic	96	72.90%	0.00%	0.00%	27.08%	NA
Intermediate	90	62.20%	6.70%	0.00%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224293976	CA -> DEL	N	N	silent_mutation	Average:53.517; most accessible tissue: Callus, score: 86.393	N	N	N	N
vg0224293976	CA -> GA	LOC_Os02g40120.1	upstream_gene_variant ; 4335.0bp to feature; MODIFIER	silent_mutation	Average:53.517; most accessible tissue: Callus, score: 86.393	N	N	N	N
vg0224293976	CA -> GA	LOC_Os02g40130.1	downstream_gene_variant ; 17.0bp to feature; MODIFIER	silent_mutation	Average:53.517; most accessible tissue: Callus, score: 86.393	N	N	N	N
vg0224293976	CA -> GA	LOC_Os02g40130-LOC_Os02g40140	intergenic_region ; MODIFIER	silent_mutation	Average:53.517; most accessible tissue: Callus, score: 86.393	N	N	N	N
vg0224293976	CA -> C	LOC_Os02g40120.1	upstream_gene_variant ; 4336.0bp to feature; MODIFIER	N	Average:53.517; most accessible tissue: Callus, score: 86.393	N	N	N	N
vg0224293976	CA -> C	LOC_Os02g40130.1	downstream_gene_variant ; 18.0bp to feature; MODIFIER	N	Average:53.517; most accessible tissue: Callus, score: 86.393	N	N	N	N
vg0224293976	CA -> C	LOC_Os02g40130-LOC_Os02g40140	intergenic_region ; MODIFIER	N	Average:53.517; most accessible tissue: Callus, score: 86.393	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224293976	6.38E-06	NA	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	7.35E-06	1.78E-09	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	8.86E-06	NA	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	6.07E-06	3.54E-10	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	4.21E-07	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	3.94E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	3.92E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	4.77E-06	1.22E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	1.73E-06	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	9.72E-06	NA	mr1101	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	6.93E-07	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	7.39E-06	3.31E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	4.72E-08	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	2.01E-06	NA	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	4.79E-06	2.00E-09	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	1.74E-07	NA	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	1.48E-07	1.17E-10	mr1202	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	4.21E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	6.32E-08	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	5.23E-06	NA	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	9.39E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	1.30E-07	NA	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	3.02E-08	5.64E-12	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	8.32E-07	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	2.15E-06	NA	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	5.56E-12	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	2.08E-10	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	4.25E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	9.31E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	1.20E-11	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	1.10E-08	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	2.57E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293976	NA	4.23E-09	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251