\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224293556:

Variant ID: vg0224293556 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24293556
Reference Allele: TAlternative Allele: A,G,TAA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, T: 0.36, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTATAATAATTTCTTTGGCCCGTTGCCTCTTCTTAACCGGCTCCAACAACTGAAAAACCTTATCCTAGGAAGCAACAGTTTGCACGGGGCTATTCCAG[T/A,G,TAA]
CTCACTTACAAATTCTTCCAGCTTGTCATACCTGGACCTCTCCACAAACCTTCTAGTTGGTGCGATTCCTGCGAACATAAGCTTACTTTCGAACCTAGAG

Reverse complement sequence

CTCTAGGTTCGAAAGTAAGCTTATGTTCGCAGGAATCGCACCAACTAGAAGGTTTGTGGAGAGGTCCAGGTATGACAAGCTGGAAGAATTTGTAAGTGAG[A/T,C,TTA]
CTGGAATAGCCCCGTGCAAACTGTTGCTTCCTAGGATAAGGTTTTTCAGTTGTTGGAGCCGGTTAAGAAGAGGCAACGGGCCAAAGAAATTATTATAGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 13.60% 2.09% 36.16% G: 5.16%
All Indica  2759 44.30% 15.60% 1.52% 32.44% G: 6.16%
All Japonica  1512 41.00% 10.80% 1.98% 41.93% G: 4.23%
Aus  269 33.80% 10.80% 8.92% 45.35% G: 1.12%
Indica I  595 55.30% 4.90% 0.50% 32.10% G: 7.23%
Indica II  465 28.20% 21.50% 2.37% 47.96% NA
Indica III  913 49.00% 15.70% 1.75% 25.19% G: 8.43%
Indica Intermediate  786 39.90% 20.20% 1.53% 31.93% G: 6.36%
Temperate Japonica  767 31.20% 11.60% 1.96% 50.46% G: 4.82%
Tropical Japonica  504 54.60% 12.30% 2.58% 25.79% G: 4.76%
Japonica Intermediate  241 44.00% 5.40% 0.83% 48.55% G: 1.24%
VI/Aromatic  96 62.50% 2.10% 2.08% 27.08% G: 6.25%
Intermediate  90 44.40% 17.80% 1.11% 35.56% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224293556 T -> TAA LOC_Os02g40130.1 frameshift_variant ; p.Ser142fs; HIGH N Average:73.981; most accessible tissue: Callus, score: 87.685 N N N N
vg0224293556 T -> G LOC_Os02g40130.1 missense_variant ; p.Val141Gly; MODERATE nonsynonymous_codon ; V141G Average:73.981; most accessible tissue: Callus, score: 87.685 benign 0.094 TOLERATED 0.15
vg0224293556 T -> A LOC_Os02g40130.1 missense_variant ; p.Val141Asp; MODERATE nonsynonymous_codon ; V141D Average:73.981; most accessible tissue: Callus, score: 87.685 benign -1.289 TOLERATED 1.00
vg0224293556 T -> DEL LOC_Os02g40130.1 N frameshift_variant Average:73.981; most accessible tissue: Callus, score: 87.685 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224293556 2.20E-06 1.52E-09 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 2.04E-06 4.93E-10 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 5.11E-08 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 2.37E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 1.42E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 1.67E-06 9.99E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 3.84E-06 5.26E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 1.19E-08 3.55E-10 mr1103 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 1.71E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 5.70E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 1.58E-06 6.64E-10 mr1149 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 2.41E-07 1.10E-09 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 1.48E-06 1.18E-06 mr1204 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 1.75E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 1.40E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 8.70E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 2.29E-06 NA mr1861 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 6.20E-09 2.21E-12 mr1861 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 4.52E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 4.10E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 1.52E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 2.11E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 7.31E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224293556 NA 4.59E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251