RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0224292809:

Variant ID: vg0224292809 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24292809
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGTCAGGATTAATTTTTCGTTGTTCCGATGTGCCTTGCACGGGCACCATTCTATGCCTGATTTTCAAACATATGACTTTTTTTATTGTTTGATTTGCA[T/C]
TTTTAAAATATTGTTGTAGCGTTAGGACATGCATATTACTAGTATATATATATTGGAGAAACAACTTTTACTGTGATATTTATGGATATTATAATCAATC

Reverse complement sequence

GATTGATTATAATATCCATAAATATCACAGTAAAAGTTGTTTCTCCAATATATATATACTAGTAATATGCATGTCCTAACGCTACAACAATATTTTAAAA[A/G]
TGCAAATCAAACAATAAAAAAAGTCATATGTTTGAAAATCAGGCATAGAATGGTGCCCGTGCAAGGCACATCGGAACAACGAAAAATTAATCCTGACATG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.20%	6.90%	1.33%	42.53%	NA
All Indica	2759	56.80%	3.50%	1.34%	38.35%	NA
All Japonica	1512	35.80%	14.60%	1.26%	48.28%	NA
Aus	269	43.90%	0.00%	1.86%	54.28%	NA
Indica I	595	64.40%	2.90%	2.18%	30.59%	NA
Indica II	465	51.00%	0.60%	1.29%	47.10%	NA
Indica III	913	56.00%	4.30%	0.88%	38.88%	NA
Indica Intermediate	786	55.60%	4.70%	1.27%	38.42%	NA
Temperate Japonica	767	42.80%	3.10%	0.78%	53.32%	NA
Tropical Japonica	504	28.80%	34.30%	1.39%	35.52%	NA
Japonica Intermediate	241	28.60%	10.00%	2.49%	58.92%	NA
VI/Aromatic	96	57.30%	3.10%	2.08%	37.50%	NA
Intermediate	90	46.70%	8.90%	0.00%	44.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224292809	T -> DEL	N	N	silent_mutation	Average:23.862; most accessible tissue: Callus, score: 85.651	N	N	N	N
vg0224292809	T -> C	LOC_Os02g40120.1	upstream_gene_variant ; 3168.0bp to feature; MODIFIER	silent_mutation	Average:23.862; most accessible tissue: Callus, score: 85.651	N	N	N	N
vg0224292809	T -> C	LOC_Os02g40130.1	upstream_gene_variant ; 326.0bp to feature; MODIFIER	silent_mutation	Average:23.862; most accessible tissue: Callus, score: 85.651	N	N	N	N
vg0224292809	T -> C	LOC_Os02g40120-LOC_Os02g40130	intergenic_region ; MODIFIER	silent_mutation	Average:23.862; most accessible tissue: Callus, score: 85.651	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224292809	NA	7.61E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224292809	8.73E-06	NA	mr1183	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224292809	1.78E-06	7.75E-08	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0224292809:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact