\
| Variant ID: vg0224292809 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24292809 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATGTCAGGATTAATTTTTCGTTGTTCCGATGTGCCTTGCACGGGCACCATTCTATGCCTGATTTTCAAACATATGACTTTTTTTATTGTTTGATTTGCA[T/C]
TTTTAAAATATTGTTGTAGCGTTAGGACATGCATATTACTAGTATATATATATTGGAGAAACAACTTTTACTGTGATATTTATGGATATTATAATCAATC
GATTGATTATAATATCCATAAATATCACAGTAAAAGTTGTTTCTCCAATATATATATACTAGTAATATGCATGTCCTAACGCTACAACAATATTTTAAAA[A/G]
TGCAAATCAAACAATAAAAAAAGTCATATGTTTGAAAATCAGGCATAGAATGGTGCCCGTGCAAGGCACATCGGAACAACGAAAAATTAATCCTGACATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.20% | 6.90% | 1.33% | 42.53% | NA |
| All Indica | 2759 | 56.80% | 3.50% | 1.34% | 38.35% | NA |
| All Japonica | 1512 | 35.80% | 14.60% | 1.26% | 48.28% | NA |
| Aus | 269 | 43.90% | 0.00% | 1.86% | 54.28% | NA |
| Indica I | 595 | 64.40% | 2.90% | 2.18% | 30.59% | NA |
| Indica II | 465 | 51.00% | 0.60% | 1.29% | 47.10% | NA |
| Indica III | 913 | 56.00% | 4.30% | 0.88% | 38.88% | NA |
| Indica Intermediate | 786 | 55.60% | 4.70% | 1.27% | 38.42% | NA |
| Temperate Japonica | 767 | 42.80% | 3.10% | 0.78% | 53.32% | NA |
| Tropical Japonica | 504 | 28.80% | 34.30% | 1.39% | 35.52% | NA |
| Japonica Intermediate | 241 | 28.60% | 10.00% | 2.49% | 58.92% | NA |
| VI/Aromatic | 96 | 57.30% | 3.10% | 2.08% | 37.50% | NA |
| Intermediate | 90 | 46.70% | 8.90% | 0.00% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224292809 | T -> DEL | N | N | silent_mutation | Average:23.862; most accessible tissue: Callus, score: 85.651 | N | N | N | N |
| vg0224292809 | T -> C | LOC_Os02g40120.1 | upstream_gene_variant ; 3168.0bp to feature; MODIFIER | silent_mutation | Average:23.862; most accessible tissue: Callus, score: 85.651 | N | N | N | N |
| vg0224292809 | T -> C | LOC_Os02g40130.1 | upstream_gene_variant ; 326.0bp to feature; MODIFIER | silent_mutation | Average:23.862; most accessible tissue: Callus, score: 85.651 | N | N | N | N |
| vg0224292809 | T -> C | LOC_Os02g40120-LOC_Os02g40130 | intergenic_region ; MODIFIER | silent_mutation | Average:23.862; most accessible tissue: Callus, score: 85.651 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224292809 | NA | 7.61E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224292809 | 8.73E-06 | NA | mr1183 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224292809 | 1.78E-06 | 7.75E-08 | mr1929_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |