\
| Variant ID: vg0224292652 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24292652 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATCTCCGGGGGGGAAGAAAATCTGCCATCTAGCTTGATCGCTCCAAGAAAGGTAATTAGTTTTTTTAACCTTTACTTACGGTGCTTAAAAAAAGTTTT[C/T]
TAAACATAATTTCTTATACATCTATTATGAGCTATGGAATGATTACAATTATGAAACATGTCAGGATTAATTTTTCGTTGTTCCGATGTGCCTTGCACGG
CCGTGCAAGGCACATCGGAACAACGAAAAATTAATCCTGACATGTTTCATAATTGTAATCATTCCATAGCTCATAATAGATGTATAAGAAATTATGTTTA[G/A]
AAAACTTTTTTTAAGCACCGTAAGTAAAGGTTAAAAAAACTAATTACCTTTCTTGGAGCGATCAAGCTAGATGGCAGATTTTCTTCCCCCCCGGAGATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.40% | 6.90% | 1.74% | 42.98% | NA |
| All Indica | 2759 | 55.70% | 3.40% | 1.99% | 38.89% | NA |
| All Japonica | 1512 | 35.50% | 14.60% | 1.19% | 48.68% | NA |
| Aus | 269 | 42.80% | 0.00% | 2.60% | 54.65% | NA |
| Indica I | 595 | 63.50% | 2.70% | 1.68% | 32.10% | NA |
| Indica II | 465 | 50.50% | 0.60% | 1.94% | 46.88% | NA |
| Indica III | 913 | 53.70% | 4.30% | 2.63% | 39.43% | NA |
| Indica Intermediate | 786 | 55.10% | 4.70% | 1.53% | 38.68% | NA |
| Temperate Japonica | 767 | 42.60% | 3.10% | 0.65% | 53.59% | NA |
| Tropical Japonica | 504 | 28.40% | 34.30% | 1.39% | 35.91% | NA |
| Japonica Intermediate | 241 | 27.80% | 10.00% | 2.49% | 59.75% | NA |
| VI/Aromatic | 96 | 57.30% | 4.20% | 1.04% | 37.50% | NA |
| Intermediate | 90 | 47.80% | 7.80% | 1.11% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224292652 | C -> T | LOC_Os02g40120.1 | upstream_gene_variant ; 3011.0bp to feature; MODIFIER | silent_mutation | Average:15.652; most accessible tissue: Callus, score: 66.145 | N | N | N | N |
| vg0224292652 | C -> T | LOC_Os02g40130.1 | upstream_gene_variant ; 483.0bp to feature; MODIFIER | silent_mutation | Average:15.652; most accessible tissue: Callus, score: 66.145 | N | N | N | N |
| vg0224292652 | C -> T | LOC_Os02g40120-LOC_Os02g40130 | intergenic_region ; MODIFIER | silent_mutation | Average:15.652; most accessible tissue: Callus, score: 66.145 | N | N | N | N |
| vg0224292652 | C -> DEL | N | N | silent_mutation | Average:15.652; most accessible tissue: Callus, score: 66.145 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224292652 | NA | 1.98E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224292652 | NA | 9.78E-06 | mr1222_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224292652 | NA | 3.51E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224292652 | 4.40E-07 | 6.64E-09 | mr1929_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |