\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224292652:

Variant ID: vg0224292652 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24292652
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATCTCCGGGGGGGAAGAAAATCTGCCATCTAGCTTGATCGCTCCAAGAAAGGTAATTAGTTTTTTTAACCTTTACTTACGGTGCTTAAAAAAAGTTTT[C/T]
TAAACATAATTTCTTATACATCTATTATGAGCTATGGAATGATTACAATTATGAAACATGTCAGGATTAATTTTTCGTTGTTCCGATGTGCCTTGCACGG

Reverse complement sequence

CCGTGCAAGGCACATCGGAACAACGAAAAATTAATCCTGACATGTTTCATAATTGTAATCATTCCATAGCTCATAATAGATGTATAAGAAATTATGTTTA[G/A]
AAAACTTTTTTTAAGCACCGTAAGTAAAGGTTAAAAAAACTAATTACCTTTCTTGGAGCGATCAAGCTAGATGGCAGATTTTCTTCCCCCCCGGAGATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 6.90% 1.74% 42.98% NA
All Indica  2759 55.70% 3.40% 1.99% 38.89% NA
All Japonica  1512 35.50% 14.60% 1.19% 48.68% NA
Aus  269 42.80% 0.00% 2.60% 54.65% NA
Indica I  595 63.50% 2.70% 1.68% 32.10% NA
Indica II  465 50.50% 0.60% 1.94% 46.88% NA
Indica III  913 53.70% 4.30% 2.63% 39.43% NA
Indica Intermediate  786 55.10% 4.70% 1.53% 38.68% NA
Temperate Japonica  767 42.60% 3.10% 0.65% 53.59% NA
Tropical Japonica  504 28.40% 34.30% 1.39% 35.91% NA
Japonica Intermediate  241 27.80% 10.00% 2.49% 59.75% NA
VI/Aromatic  96 57.30% 4.20% 1.04% 37.50% NA
Intermediate  90 47.80% 7.80% 1.11% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224292652 C -> T LOC_Os02g40120.1 upstream_gene_variant ; 3011.0bp to feature; MODIFIER silent_mutation Average:15.652; most accessible tissue: Callus, score: 66.145 N N N N
vg0224292652 C -> T LOC_Os02g40130.1 upstream_gene_variant ; 483.0bp to feature; MODIFIER silent_mutation Average:15.652; most accessible tissue: Callus, score: 66.145 N N N N
vg0224292652 C -> T LOC_Os02g40120-LOC_Os02g40130 intergenic_region ; MODIFIER silent_mutation Average:15.652; most accessible tissue: Callus, score: 66.145 N N N N
vg0224292652 C -> DEL N N silent_mutation Average:15.652; most accessible tissue: Callus, score: 66.145 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224292652 NA 1.98E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224292652 NA 9.78E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224292652 NA 3.51E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224292652 4.40E-07 6.64E-09 mr1929_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251