\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224288814:

Variant ID: vg0224288814 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24288814
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAACAAAAGAGAACAAAAACCTTGAAGAGAATTTTCTGAAAACATCAAGGGCGTACTGGCCCCAGCCCAGGTTGCTTCGGCCCAGCCCTGGACATGGTG[G/A]
CTCCTTATCGGCTTCTTTCTTGGGCCATGTATATGGCGTCAGAACTCAGAAGTCGATTCCGCAACAGGAAGAACTCATCCCTCTGGTTCCTCTTCCCGCA

Reverse complement sequence

TGCGGGAAGAGGAACCAGAGGGATGAGTTCTTCCTGTTGCGGAATCGACTTCTGAGTTCTGACGCCATATACATGGCCCAAGAAAGAAGCCGATAAGGAG[C/T]
CACCATGTCCAGGGCTGGGCCGAAGCAACCTGGGCTGGGGCCAGTACGCCCTTGATGTTTTCAGAAAATTCTCTTCAAGGTTTTTGTTCTCTTTTGTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 16.10% 1.18% 2.12% NA
All Indica  2759 84.90% 12.70% 0.80% 1.59% NA
All Japonica  1512 74.30% 21.80% 1.79% 2.12% NA
Aus  269 74.00% 14.50% 2.60% 8.92% NA
Indica I  595 89.40% 10.40% 0.17% 0.00% NA
Indica II  465 87.70% 12.00% 0.22% 0.00% NA
Indica III  913 81.80% 13.70% 0.77% 3.72% NA
Indica Intermediate  786 83.50% 13.60% 1.65% 1.27% NA
Temperate Japonica  767 65.60% 28.40% 2.35% 3.65% NA
Tropical Japonica  504 85.10% 13.50% 1.19% 0.20% NA
Japonica Intermediate  241 79.30% 18.30% 1.24% 1.24% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224288814 G -> A LOC_Os02g40110.1 upstream_gene_variant ; 4010.0bp to feature; MODIFIER silent_mutation Average:89.248; most accessible tissue: Minghui63 root, score: 95.441 N N N N
vg0224288814 G -> A LOC_Os02g40130.1 upstream_gene_variant ; 4321.0bp to feature; MODIFIER silent_mutation Average:89.248; most accessible tissue: Minghui63 root, score: 95.441 N N N N
vg0224288814 G -> A LOC_Os02g40120.1 downstream_gene_variant ; 5.0bp to feature; MODIFIER silent_mutation Average:89.248; most accessible tissue: Minghui63 root, score: 95.441 N N N N
vg0224288814 G -> A LOC_Os02g40110-LOC_Os02g40120 intergenic_region ; MODIFIER silent_mutation Average:89.248; most accessible tissue: Minghui63 root, score: 95.441 N N N N
vg0224288814 G -> DEL N N silent_mutation Average:89.248; most accessible tissue: Minghui63 root, score: 95.441 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224288814 G A -0.01 -0.03 -0.02 -0.04 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224288814 1.53E-06 6.32E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224288814 1.98E-07 3.93E-07 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251