\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224286805:

Variant ID: vg0224286805 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24286805
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCAAAAGCTTCAGCTCTGACCTCACTCCTCACTAAGCCATCCCCTTGCAGTTTAATTTGGAGGTACAAAACGCCGGTGGACGTAAGCCGGATGGCACG[C/T]
GAGAACAGACGTCAGATATATACCAAATCCTATGAAAAGTAATATGTTCTTTCTCCGATGCGTCGGTGTCGCGGCAAACGTCAGATGCCCGCATGATCAT

Reverse complement sequence

ATGATCATGCGGGCATCTGACGTTTGCCGCGACACCGACGCATCGGAGAAAGAACATATTACTTTTCATAGGATTTGGTATATATCTGACGTCTGTTCTC[G/A]
CGTGCCATCCGGCTTACGTCCACCGGCGTTTTGTACCTCCAAATTAAACTGCAAGGGGATGGCTTAGTGAGGAGTGAGGTCAGAGCTGAAGCTTTTGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 12.90% 0.72% 0.68% NA
All Indica  2759 85.20% 13.40% 0.83% 0.62% NA
All Japonica  1512 86.60% 12.00% 0.53% 0.79% NA
Aus  269 87.00% 11.90% 1.12% 0.00% NA
Indica I  595 96.30% 1.70% 2.02% 0.00% NA
Indica II  465 82.80% 17.20% 0.00% 0.00% NA
Indica III  913 81.80% 16.40% 0.44% 1.31% NA
Indica Intermediate  786 82.10% 16.40% 0.89% 0.64% NA
Temperate Japonica  767 96.90% 2.00% 0.39% 0.78% NA
Tropical Japonica  504 71.20% 26.80% 0.99% 0.99% NA
Japonica Intermediate  241 86.30% 13.30% 0.00% 0.41% NA
VI/Aromatic  96 85.40% 11.50% 0.00% 3.12% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224286805 C -> T LOC_Os02g40110.1 upstream_gene_variant ; 2001.0bp to feature; MODIFIER silent_mutation Average:88.174; most accessible tissue: Minghui63 root, score: 99.316 N N N N
vg0224286805 C -> T LOC_Os02g40120.1 downstream_gene_variant ; 2014.0bp to feature; MODIFIER silent_mutation Average:88.174; most accessible tissue: Minghui63 root, score: 99.316 N N N N
vg0224286805 C -> T LOC_Os02g40110-LOC_Os02g40120 intergenic_region ; MODIFIER silent_mutation Average:88.174; most accessible tissue: Minghui63 root, score: 99.316 N N N N
vg0224286805 C -> DEL N N silent_mutation Average:88.174; most accessible tissue: Minghui63 root, score: 99.316 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224286805 C T 0.06 0.12 0.11 0.1 0.12 0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224286805 NA 2.80E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 3.19E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 2.29E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 5.67E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 6.97E-06 NA mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 1.53E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 4.78E-06 NA mr1503 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 1.39E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 2.21E-10 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 6.80E-09 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 4.40E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 2.09E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 1.44E-06 9.95E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 4.54E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 9.63E-06 4.78E-07 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224286805 NA 3.60E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251