\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224284988:

Variant ID: vg0224284988 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24284988
Reference Allele: AAlternative Allele: T,AAGGC
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGAGGTGGGGCGAGGTCATGGACATGGTGGTCGTGCCTGGACTGATTCGTGTGACCTGTTGAGTTGTCGTGGGGGTTTGGTTTGGTGAGTGGTCTAGG[A/T,AAGGC]
AGGCAGGCGCGGCAAGGGAGGAGGCTGACTGGCTCAACGGAAGCAGGCGAGGAGGAGGAGGAACGGGAGGGCGGTTGGAGATGGAAAGGTTTTTAAGCCG

Reverse complement sequence

CGGCTTAAAAACCTTTCCATCTCCAACCGCCCTCCCGTTCCTCCTCCTCCTCGCCTGCTTCCGTTGAGCCAGTCAGCCTCCTCCCTTGCCGCGCCTGCCT[T/A,GCCTT]
CCTAGACCACTCACCAAACCAAACCCCCACGACAACTCAACAGGTCACACGAATCAGTCCAGGCACGACCACCATGTCCATGACCTCGCCCCACCTCGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.20% 36.60% 0.38% 0.00% AAGGC: 19.83%
All Indica  2759 42.50% 37.00% 0.47% 0.00% AAGGC: 20.08%
All Japonica  1512 41.80% 35.10% 0.26% 0.00% AAGGC: 22.88%
Aus  269 64.70% 32.70% 0.00% 0.00% AAGGC: 2.60%
Indica I  595 11.30% 57.10% 0.67% 0.00% AAGGC: 30.92%
Indica II  465 59.10% 20.90% 0.86% 0.00% AAGGC: 19.14%
Indica III  913 50.90% 35.90% 0.11% 0.00% AAGGC: 13.03%
Indica Intermediate  786 46.40% 32.40% 0.51% 0.00% AAGGC: 20.61%
Temperate Japonica  767 40.40% 36.10% 0.26% 0.00% AAGGC: 23.21%
Tropical Japonica  504 43.80% 35.10% 0.00% 0.00% AAGGC: 21.03%
Japonica Intermediate  241 41.90% 31.50% 0.83% 0.00% AAGGC: 25.73%
VI/Aromatic  96 30.20% 61.50% 0.00% 0.00% AAGGC: 8.33%
Intermediate  90 36.70% 37.80% 1.11% 0.00% AAGGC: 24.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224284988 A -> T LOC_Os02g40110.1 upstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:97.339; most accessible tissue: Zhenshan97 root, score: 99.581 N N N N
vg0224284988 A -> T LOC_Os02g40100.1 downstream_gene_variant ; 3947.0bp to feature; MODIFIER silent_mutation Average:97.339; most accessible tissue: Zhenshan97 root, score: 99.581 N N N N
vg0224284988 A -> T LOC_Os02g40120.1 downstream_gene_variant ; 3831.0bp to feature; MODIFIER silent_mutation Average:97.339; most accessible tissue: Zhenshan97 root, score: 99.581 N N N N
vg0224284988 A -> T LOC_Os02g40110-LOC_Os02g40120 intergenic_region ; MODIFIER silent_mutation Average:97.339; most accessible tissue: Zhenshan97 root, score: 99.581 N N N N
vg0224284988 A -> AAGGC LOC_Os02g40110.1 upstream_gene_variant ; 185.0bp to feature; MODIFIER silent_mutation Average:97.339; most accessible tissue: Zhenshan97 root, score: 99.581 N N N N
vg0224284988 A -> AAGGC LOC_Os02g40100.1 downstream_gene_variant ; 3948.0bp to feature; MODIFIER silent_mutation Average:97.339; most accessible tissue: Zhenshan97 root, score: 99.581 N N N N
vg0224284988 A -> AAGGC LOC_Os02g40120.1 downstream_gene_variant ; 3830.0bp to feature; MODIFIER silent_mutation Average:97.339; most accessible tissue: Zhenshan97 root, score: 99.581 N N N N
vg0224284988 A -> AAGGC LOC_Os02g40110-LOC_Os02g40120 intergenic_region ; MODIFIER silent_mutation Average:97.339; most accessible tissue: Zhenshan97 root, score: 99.581 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224284988 A AAGGC 0.24 -0.19 -0.14 0.12 0.09 0.07
vg0224284988 A T 0.08 0.06 0.05 0.04 0.06 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224284988 NA 1.87E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.70E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.12E-08 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 3.24E-08 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.91E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 7.29E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 9.63E-08 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 3.58E-07 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.18E-08 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.22E-08 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.39E-10 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 3.14E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.07E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 9.15E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.53E-06 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 7.04E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.26E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 2.89E-09 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 4.75E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 3.94E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 3.46E-07 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 8.08E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.10E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 3.87E-06 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 3.01E-06 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.11E-10 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 8.27E-09 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 4.85E-07 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 8.42E-09 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.25E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 6.26E-11 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 5.91E-11 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.53E-10 mr1074_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 8.94E-11 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 8.17E-10 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 1.29E-06 8.55E-12 mr1095_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 7.07E-06 1.08E-10 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 2.38E-06 2.05E-12 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.15E-09 mr1123_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 9.96E-17 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 6.04E-08 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.54E-07 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 5.17E-09 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 3.31E-11 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 7.33E-11 mr1222_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 1.88E-09 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 2.47E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 5.13E-14 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 5.59E-06 mr1911_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 6.83E-09 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 7.18E-06 mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 2.49E-10 mr1936_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224284988 NA 6.17E-13 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251