Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224284161:

Variant ID: vg0224284161 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24284161
Reference Allele: GAlternative Allele: T,A,GT
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCTCGAAGTAGGCGTCCTGCGGGAACGGCGCGCCGGCGAGGGGCGGGCCGGGCAGCGGCAGGCTCATCCTGGCGAGGCACAGGGCGCTGCTGTTCCCC[G/T,A,GT]
CCGCATCGTGGTCGCCGCCGCGGAGCGGGCTCGGGATGCTCCCGGGGAGCCACTTCTTGGTGGACGCCGAGACGGCCGCCGCCGCCGCGGCCACCACCGG

Reverse complement sequence

CCGGTGGTGGCCGCGGCGGCGGCGGCCGTCTCGGCGTCCACCAAGAAGTGGCTCCCCGGGAGCATCCCGAGCCCGCTCCGCGGCGGCGACCACGATGCGG[C/A,T,AC]
GGGGAACAGCAGCGCCCTGTGCCTCGCCAGGATGAGCCTGCCGCTGCCCGGCCCGCCCCTCGCCGGCGCGCCGTTCCCGCAGGACGCCTACTTCGAGATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.70% 2.20% 0.06% 0.00% A: 0.04%
All Indica  2759 99.30% 0.60% 0.00% 0.00% A: 0.07%
All Japonica  1512 94.20% 5.60% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.90% 0.90% 0.00% 0.00% A: 0.22%
Indica Intermediate  786 98.90% 1.10% 0.00% 0.00% NA
Temperate Japonica  767 97.10% 2.60% 0.26% 0.00% NA
Tropical Japonica  504 89.10% 10.90% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224284161 G -> A LOC_Os02g40110.1 missense_variant ; p.Ala215Val; MODERATE nonsynonymous_codon ; A215V Average:89.378; most accessible tissue: Zhenshan97 flag leaf, score: 98.206 unknown unknown DELETERIOUS 0.03
vg0224284161 G -> T LOC_Os02g40110.1 missense_variant ; p.Ala215Glu; MODERATE nonsynonymous_codon ; A215E Average:89.378; most accessible tissue: Zhenshan97 flag leaf, score: 98.206 unknown unknown DELETERIOUS 0.02
vg0224284161 G -> GT LOC_Os02g40110.1 frameshift_variant ; p.Ala215fs; HIGH N Average:89.378; most accessible tissue: Zhenshan97 flag leaf, score: 98.206 N N N N
vg0224284161 G -> GT LOC_Os02g40100.1 downstream_gene_variant ; 3121.0bp to feature; MODIFIER N Average:89.378; most accessible tissue: Zhenshan97 flag leaf, score: 98.206 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224284161 G A -0.01 -0.01 -0.01 0.0 -0.01 -0.01
vg0224284161 G GT -0.03 -0.04 -0.03 -0.04 0.0 0.07
vg0224284161 G T -0.01 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224284161 5.68E-07 5.68E-07 mr1470 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251