Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224283930:

Variant ID: vg0224283930 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24283930
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.17, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGCGGCGGACGCGGCGGTGGCGAGGCCGAACGACATGACCGTGTGCCGCTGCTTGTCGTGGTGATCGTCGACTTTCGTGGCGGCTCTGGTTTCTTGG[A/G]
CCGCGTTCTTGGCGTCCGGTGCAAAGCTGATGAGCTTGGCGCGGTCGCTCTCGCTGGAGCCGTCCCTGCCGCGGCGGCTCGCCCTCGACGCCGACCACTC

Reverse complement sequence

GAGTGGTCGGCGTCGAGGGCGAGCCGCCGCGGCAGGGACGGCTCCAGCGAGAGCGACCGCGCCAAGCTCATCAGCTTTGCACCGGACGCCAAGAACGCGG[T/C]
CCAAGAAACCAGAGCCGCCACGAAAGTCGACGATCACCACGACAAGCAGCGGCACACGGTCATGTCGTTCGGCCTCGCCACCGCCGCGTCCGCCGCGCCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 36.70% 0.17% 0.00% NA
All Indica  2759 59.80% 40.00% 0.18% 0.00% NA
All Japonica  1512 66.60% 33.30% 0.13% 0.00% NA
Aus  269 86.20% 13.80% 0.00% 0.00% NA
Indica I  595 23.00% 76.50% 0.50% 0.00% NA
Indica II  465 64.10% 35.90% 0.00% 0.00% NA
Indica III  913 77.00% 23.00% 0.00% 0.00% NA
Indica Intermediate  786 65.10% 34.60% 0.25% 0.00% NA
Temperate Japonica  767 54.80% 45.00% 0.26% 0.00% NA
Tropical Japonica  504 83.70% 16.30% 0.00% 0.00% NA
Japonica Intermediate  241 68.50% 31.50% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 60.40% 1.04% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224283930 A -> G LOC_Os02g40110.1 missense_variant ; p.Val292Ala; MODERATE nonsynonymous_codon ; V292A Average:91.649; most accessible tissue: Zhenshan97 flag leaf, score: 98.566 benign -0.135 TOLERATED 0.45

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224283930 A G -0.03 -0.06 -0.06 -0.01 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224283930 NA 2.96E-12 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 2.33E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 1.15E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 3.65E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 3.52E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 1.65E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 4.50E-09 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 1.47E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 1.36E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 3.60E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 5.34E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 7.14E-07 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 3.81E-11 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 5.79E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 1.06E-09 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 3.75E-11 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 3.02E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 7.16E-11 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 4.97E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 2.45E-06 2.45E-06 mr1081_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 9.75E-08 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 2.44E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 5.53E-08 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 1.08E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 2.92E-13 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 8.64E-09 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 7.51E-09 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 1.19E-08 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 7.69E-06 mr1240_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 5.43E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 1.07E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 5.70E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 4.01E-11 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 4.81E-08 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224283930 NA 5.87E-10 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251