\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224274079:

Variant ID: vg0224274079 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24274079
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


ACGATAGAGAAACACGACTTAAAAGATAGGAATGATGCTCATCCATCAGACTAGTCTTTTGGGTTGTATAGGCCTAGAATCTAAAGTTATAACTCCGGTT[G/A]
GACCTGTGGTGGAACAGATCTAATGTGACTGTGACCTAGGTGACCCATGGTTGATGGGTCAGGATGCGCACTTTAACTTGAAAACGTGTCGGGGAAATCA

Reverse complement sequence

TGATTTCCCCGACACGTTTTCAAGTTAAAGTGCGCATCCTGACCCATCAACCATGGGTCACCTAGGTCACAGTCACATTAGATCTGTTCCACCACAGGTC[C/T]
AACCGGAGTTATAACTTTAGATTCTAGGCCTATACAACCCAAAAGACTAGTCTGATGGATGAGCATCATTCCTATCTTTTAAGTCGTGTTTCTCTATCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 17.00% 0.15% 0.00% NA
All Indica  2759 84.80% 15.10% 0.07% 0.00% NA
All Japonica  1512 81.20% 18.50% 0.33% 0.00% NA
Aus  269 70.30% 29.70% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 76.30% 23.70% 0.00% 0.00% NA
Indica III  913 83.50% 16.50% 0.00% 0.00% NA
Indica Intermediate  786 81.20% 18.60% 0.25% 0.00% NA
Temperate Japonica  767 87.20% 12.40% 0.39% 0.00% NA
Tropical Japonica  504 77.60% 22.40% 0.00% 0.00% NA
Japonica Intermediate  241 69.30% 29.90% 0.83% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224274079 G -> A LOC_Os02g40090.1 upstream_gene_variant ; 404.0bp to feature; MODIFIER silent_mutation Average:93.699; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N
vg0224274079 G -> A LOC_Os02g40100.1 upstream_gene_variant ; 2229.0bp to feature; MODIFIER silent_mutation Average:93.699; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N
vg0224274079 G -> A LOC_Os02g40090.4 upstream_gene_variant ; 554.0bp to feature; MODIFIER silent_mutation Average:93.699; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N
vg0224274079 G -> A LOC_Os02g40090.5 upstream_gene_variant ; 518.0bp to feature; MODIFIER silent_mutation Average:93.699; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N
vg0224274079 G -> A LOC_Os02g40090.3 upstream_gene_variant ; 405.0bp to feature; MODIFIER silent_mutation Average:93.699; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N
vg0224274079 G -> A LOC_Os02g40080.1 downstream_gene_variant ; 4058.0bp to feature; MODIFIER silent_mutation Average:93.699; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N
vg0224274079 G -> A LOC_Os02g40090-LOC_Os02g40100 intergenic_region ; MODIFIER silent_mutation Average:93.699; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224274079 G A -0.02 -0.02 -0.02 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224274079 NA 2.04E-09 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 4.91E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 1.19E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 2.93E-08 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 4.45E-06 2.37E-10 mr1124 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 7.67E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 5.10E-09 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 7.14E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 2.00E-08 mr1592 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 9.30E-09 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 5.88E-09 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 1.60E-10 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 2.40E-10 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 7.52E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 4.42E-08 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 5.04E-08 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 2.28E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 1.92E-08 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 5.87E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 2.82E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 2.48E-06 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 1.48E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 3.48E-08 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 1.27E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 8.36E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 4.85E-06 8.71E-08 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 6.55E-06 2.22E-06 mr1911_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 7.95E-07 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224274079 NA 1.07E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251