\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224267593:

Variant ID: vg0224267593 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24267593
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGGGAAGGGAGTGACCTCGCCGCCGTCCCTCTCTTCTCCACCGTTACCGAGTTGGGCGGTTTTATGCGACCTCACGGCCGTCTCCGATGTCAGCTGCC[C/T]
TGTTTCCGGTCGTTCCTGAGCCACCCCCAACCCCACTCCACCTCCTTGCTGCCATGGTTGCGATGGCAGCCGCCACCACCACATCGCATCTCCTAACCAT

Reverse complement sequence

ATGGTTAGGAGATGCGATGTGGTGGTGGCGGCTGCCATCGCAACCATGGCAGCAAGGAGGTGGAGTGGGGTTGGGGGTGGCTCAGGAACGACCGGAAACA[G/A]
GGCAGCTGACATCGGAGACGGCCGTGAGGTCGCATAAAACCGCCCAACTCGGTAACGGTGGAGAAGAGAGGGACGGCGGCGAGGTCACTCCCTTCCCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 20.90% 0.49% 0.00% NA
All Indica  2759 72.60% 27.10% 0.33% 0.00% NA
All Japonica  1512 86.00% 13.20% 0.86% 0.00% NA
Aus  269 95.50% 4.10% 0.37% 0.00% NA
Indica I  595 60.30% 39.70% 0.00% 0.00% NA
Indica II  465 80.90% 18.50% 0.65% 0.00% NA
Indica III  913 73.60% 26.30% 0.11% 0.00% NA
Indica Intermediate  786 75.80% 23.50% 0.64% 0.00% NA
Temperate Japonica  767 83.80% 15.80% 0.39% 0.00% NA
Tropical Japonica  504 91.50% 6.50% 1.98% 0.00% NA
Japonica Intermediate  241 81.30% 18.70% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224267593 C -> T LOC_Os02g40080.1 upstream_gene_variant ; 558.0bp to feature; MODIFIER silent_mutation Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601 N N N N
vg0224267593 C -> T LOC_Os02g40070.1 downstream_gene_variant ; 1296.0bp to feature; MODIFIER silent_mutation Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601 N N N N
vg0224267593 C -> T LOC_Os02g40090.1 downstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601 N N N N
vg0224267593 C -> T LOC_Os02g40090.4 downstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601 N N N N
vg0224267593 C -> T LOC_Os02g40090.5 downstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601 N N N N
vg0224267593 C -> T LOC_Os02g40090.3 downstream_gene_variant ; 2646.0bp to feature; MODIFIER silent_mutation Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601 N N N N
vg0224267593 C -> T LOC_Os02g40070-LOC_Os02g40080 intergenic_region ; MODIFIER silent_mutation Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224267593 C T -0.01 -0.01 -0.01 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224267593 7.04E-06 7.04E-06 mr1015 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 1.56E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 1.43E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 3.04E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 1.89E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 8.60E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 3.00E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 8.65E-06 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 5.33E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 1.13E-07 1.13E-07 mr1412 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 2.21E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 6.43E-06 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 1.04E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 2.75E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 9.42E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 5.92E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 7.22E-07 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593 NA 8.29E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251