Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224263868:

Variant ID: vg0224263868 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 24263868
Reference Allele: A	Alternative Allele: T,AAT
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.06, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

ATCGCCTAATGACTCTATCCGGAATGACACCGTTATGCTCCGCAATGCGCAGTTTATCTTGGTATGCATGCAAACGCCTTCAGTTTTTTTTTCATTGTAT[A/T,AAT]
TAACTATATTAGTGACTGCACAATCATTATACTTGTATCACGACTACTCAGGTGGCTATGACAAGGAGGATAAAGCAGCGAGAGCTTATGATTTGGCAGC

Reverse complement sequence

GCTGCCAAATCATAAGCTCTCGCTGCTTTATCCTCCTTGTCATAGCCACCTGAGTAGTCGTGATACAAGTATAATGATTGTGCAGTCACTAATATAGTTA[T/A,ATT]
ATACAATGAAAAAAAAACTGAAGGCGTTTGCATGCATACCAAGATAAACTGCGCATTGCGGAGCATAACGGTGTCATTCCGGATAGAGTCATTAGGCGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.90%	44.80%	0.72%	0.00%	AAT: 2.60%
All Indica	2759	67.20%	32.40%	0.29%	0.00%	AAT: 0.04%
All Japonica	1512	23.50%	67.20%	1.52%	0.00%	AAT: 7.74%
Aus	269	61.70%	37.90%	0.37%	0.00%	NA
Indica I	595	94.80%	4.90%	0.34%	0.00%	NA
Indica II	465	51.20%	48.80%	0.00%	0.00%	NA
Indica III	913	63.30%	36.50%	0.22%	0.00%	NA
Indica Intermediate	786	60.40%	38.90%	0.51%	0.00%	AAT: 0.13%
Temperate Japonica	767	20.70%	66.50%	2.87%	0.00%	AAT: 9.91%
Tropical Japonica	504	32.90%	66.70%	0.20%	0.00%	AAT: 0.20%
Japonica Intermediate	241	12.90%	70.50%	0.00%	0.00%	AAT: 16.60%
VI/Aromatic	96	37.50%	62.50%	0.00%	0.00%	NA
Intermediate	90	45.60%	46.70%	2.22%	0.00%	AAT: 5.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224263868	A -> AAT	LOC_Os02g40080.1	upstream_gene_variant ; 4282.0bp to feature; MODIFIER	silent_mutation	Average:38.169; most accessible tissue: Callus, score: 64.527	N	N	N	N
vg0224263868	A -> AAT	LOC_Os02g40070.1	intron_variant ; MODIFIER	silent_mutation	Average:38.169; most accessible tissue: Callus, score: 64.527	N	N	N	N
vg0224263868	A -> T	LOC_Os02g40080.1	upstream_gene_variant ; 4283.0bp to feature; MODIFIER	silent_mutation	Average:38.169; most accessible tissue: Callus, score: 64.527	N	N	N	N
vg0224263868	A -> T	LOC_Os02g40070.1	intron_variant ; MODIFIER	silent_mutation	Average:38.169; most accessible tissue: Callus, score: 64.527	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224263868	NA	2.30E-09	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.88E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	5.83E-06	mr1095	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	6.47E-08	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	3.99E-06	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.93E-07	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	5.30E-09	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.37E-08	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	6.21E-09	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	5.47E-09	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	5.46E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.28E-07	mr1254	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	8.61E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.97E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.11E-06	mr1589	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.82E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	8.14E-06	mr1858	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	8.55E-06	mr1859	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	6.51E-09	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	7.66E-07	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	7.89E-10	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	7.79E-10	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.07E-11	mr1074_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	7.53E-09	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	3.78E-09	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	2.39E-09	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	6.66E-07	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	4.63E-09	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.52E-06	mr1146_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	5.03E-10	mr1148_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	2.83E-06	1.69E-12	mr1150_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	1.82E-07	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	4.58E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	3.52E-06	mr1227_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	6.49E-07	mr1240_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	2.86E-06	mr1256_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	5.99E-06	mr1622_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	6.13E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	9.24E-07	mr1911_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	4.11E-08	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	5.11E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263868	NA	4.19E-10	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251