\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224263783:

Variant ID: vg0224263783 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24263783
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.04, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCTCCAGCATAACACTACGTATGTATATATGTACACTTAATTTACAGTACTGATTAAGCATTCTTTCAATTCGTCTGTTCCCCATCGCCTAATGACTC[T/G]
ATCCGGAATGACACCGTTATGCTCCGCAATGCGCAGTTTATCTTGGTATGCATGCAAACGCCTTCAGTTTTTTTTTCATTGTATATAACTATATTAGTGA

Reverse complement sequence

TCACTAATATAGTTATATACAATGAAAAAAAAACTGAAGGCGTTTGCATGCATACCAAGATAAACTGCGCATTGCGGAGCATAACGGTGTCATTCCGGAT[A/C]
GAGTCATTAGGCGATGGGGAACAGACGAATTGAAAGAATGCTTAATCAGTACTGTAAATTAAGTGTACATATATACATACGTAGTGTTATGCTGGAGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 37.10% 0.44% 0.00% NA
All Indica  2759 72.70% 27.00% 0.29% 0.00% NA
All Japonica  1512 42.90% 56.40% 0.73% 0.00% NA
Aus  269 66.90% 33.10% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 61.70% 38.30% 0.00% 0.00% NA
Indica III  913 67.90% 31.80% 0.33% 0.00% NA
Indica Intermediate  786 67.20% 32.20% 0.64% 0.00% NA
Temperate Japonica  767 42.50% 56.20% 1.30% 0.00% NA
Tropical Japonica  504 46.80% 53.00% 0.20% 0.00% NA
Japonica Intermediate  241 35.70% 64.30% 0.00% 0.00% NA
VI/Aromatic  96 60.40% 38.50% 1.04% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224263783 T -> G LOC_Os02g40080.1 upstream_gene_variant ; 4368.0bp to feature; MODIFIER silent_mutation Average:45.225; most accessible tissue: Callus, score: 83.806 N N N N
vg0224263783 T -> G LOC_Os02g40070.1 intron_variant ; MODIFIER silent_mutation Average:45.225; most accessible tissue: Callus, score: 83.806 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224263783 NA 3.73E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 5.45E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 2.12E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 1.42E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 4.07E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 4.46E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 1.33E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 1.81E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 9.76E-09 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 1.39E-08 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 1.03E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 5.98E-08 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 2.74E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 1.99E-07 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 3.03E-09 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 2.37E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 7.97E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 3.31E-08 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 7.91E-06 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 4.07E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 4.59E-06 2.30E-06 mr1911_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224263783 NA 1.12E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251