\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224260935:

Variant ID: vg0224260935 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24260935
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.08, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATCCAAGGATATGTCGTCCCTGATCGATCTCGTTCTTGTTAAGCTTATTTATTCGGCTAGCTAGCTCTTTCCCGCCACTGCTTGCATTGGTATATAT[A/G]
TTTGGATTGATCGAGCTCCTCGATCTACATGTCATGCATGTCGTCTTTTGTTTGGGTTCAGATTCATACTAATTAAAAGGAGAACTTGATCCATGCTATA

Reverse complement sequence

TATAGCATGGATCAAGTTCTCCTTTTAATTAGTATGAATCTGAACCCAAACAAAAGACGACATGCATGACATGTAGATCGAGGAGCTCGATCAATCCAAA[T/C]
ATATATACCAATGCAAGCAGTGGCGGGAAAGAGCTAGCTAGCCGAATAAATAAGCTTAACAAGAACGAGATCGATCAGGGACGACATATCCTTGGATCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 22.00% 0.36% 0.00% NA
All Indica  2759 74.20% 25.40% 0.36% 0.00% NA
All Japonica  1512 81.20% 18.60% 0.26% 0.00% NA
Aus  269 92.20% 7.10% 0.74% 0.00% NA
Indica I  595 66.20% 33.30% 0.50% 0.00% NA
Indica II  465 71.80% 28.00% 0.22% 0.00% NA
Indica III  913 79.20% 20.70% 0.11% 0.00% NA
Indica Intermediate  786 75.80% 23.50% 0.64% 0.00% NA
Temperate Japonica  767 87.00% 12.60% 0.39% 0.00% NA
Tropical Japonica  504 65.70% 34.10% 0.20% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224260935 A -> G LOC_Os02g40060.1 upstream_gene_variant ; 3480.0bp to feature; MODIFIER silent_mutation Average:55.561; most accessible tissue: Callus, score: 95.934 N N N N
vg0224260935 A -> G LOC_Os02g40070.1 upstream_gene_variant ; 736.0bp to feature; MODIFIER silent_mutation Average:55.561; most accessible tissue: Callus, score: 95.934 N N N N
vg0224260935 A -> G LOC_Os02g40060-LOC_Os02g40070 intergenic_region ; MODIFIER silent_mutation Average:55.561; most accessible tissue: Callus, score: 95.934 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224260935 2.27E-06 2.97E-08 mr1074 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 6.00E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 6.94E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 3.29E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 8.43E-06 2.93E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 7.96E-06 mr1146 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 3.53E-06 2.78E-08 mr1148 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 2.88E-07 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 1.45E-06 1.62E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 7.64E-06 8.28E-07 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 5.59E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 5.88E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 3.76E-08 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 3.11E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 2.45E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 5.75E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 5.30E-07 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 5.74E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 2.29E-08 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224260935 NA 1.34E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251