\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224251301:

Variant ID: vg0224251301 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24251301
Reference Allele: AAlternative Allele: C,AATTT
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAAGCATCCCTTATTGCAGAGGACCATGCCTTGCATGTGTCAACCGCTGCATCTGCATGAGGCAAGACAGTGAGTTCAGCAGCCAGCCAGCGTGAGAC[A/C,AATTT]
ATCTGCATGCTGTGCCCAGCAACCGACATTTTCCTCTCTCTGCAGGGCAGAATCACGGAAGCTAGCCCTGTGTATTTACATTGATCAATGCTAGATTCGC

Reverse complement sequence

GCGAATCTAGCATTGATCAATGTAAATACACAGGGCTAGCTTCCGTGATTCTGCCCTGCAGAGAGAGGAAAATGTCGGTTGCTGGGCACAGCATGCAGAT[T/G,AAATT]
GTCTCACGCTGGCTGGCTGCTGAACTCACTGTCTTGCCTCATGCAGATGCAGCGGTTGACACATGCAAGGCATGGTCCTCTGCAATAAGGGATGCTTGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 19.40% 0.57% 0.34% AATTT: 0.04%
All Indica  2759 84.10% 15.40% 0.43% 0.04% NA
All Japonica  1512 76.40% 22.70% 0.79% 0.13% NA
Aus  269 72.50% 27.10% 0.37% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 64.90% 34.40% 0.65% 0.00% NA
Indica III  913 86.30% 13.40% 0.22% 0.11% NA
Indica Intermediate  786 81.70% 17.70% 0.64% 0.00% NA
Temperate Japonica  767 94.10% 5.00% 0.91% 0.00% NA
Tropical Japonica  504 53.80% 45.60% 0.60% 0.00% NA
Japonica Intermediate  241 67.20% 31.10% 0.83% 0.83% NA
VI/Aromatic  96 31.20% 58.30% 0.00% 10.42% NA
Intermediate  90 71.10% 21.10% 2.22% 3.33% AATTT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224251301 A -> AATTT LOC_Os02g40050.1 downstream_gene_variant ; 3002.0bp to feature; MODIFIER silent_mutation Average:86.714; most accessible tissue: Callus, score: 96.552 N N N N
vg0224251301 A -> AATTT LOC_Os02g40060.1 downstream_gene_variant ; 4756.0bp to feature; MODIFIER silent_mutation Average:86.714; most accessible tissue: Callus, score: 96.552 N N N N
vg0224251301 A -> AATTT LOC_Os02g40040-LOC_Os02g40050 intergenic_region ; MODIFIER silent_mutation Average:86.714; most accessible tissue: Callus, score: 96.552 N N N N
vg0224251301 A -> DEL N N silent_mutation Average:86.714; most accessible tissue: Callus, score: 96.552 N N N N
vg0224251301 A -> C LOC_Os02g40050.1 downstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:86.714; most accessible tissue: Callus, score: 96.552 N N N N
vg0224251301 A -> C LOC_Os02g40060.1 downstream_gene_variant ; 4757.0bp to feature; MODIFIER silent_mutation Average:86.714; most accessible tissue: Callus, score: 96.552 N N N N
vg0224251301 A -> C LOC_Os02g40040-LOC_Os02g40050 intergenic_region ; MODIFIER silent_mutation Average:86.714; most accessible tissue: Callus, score: 96.552 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224251301 A AATTT -0.01 -0.11 -0.07 0.3 0.14 0.08
vg0224251301 A C -0.01 0.02 0.01 0.04 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224251301 NA 3.36E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 2.61E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 3.67E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 3.36E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 5.99E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 9.75E-07 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 1.24E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 2.15E-08 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 7.08E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 4.99E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 8.11E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 2.79E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 4.40E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 6.24E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 1.92E-08 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 3.09E-09 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 4.96E-06 8.36E-11 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 8.78E-07 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 1.21E-06 3.71E-09 mr1074_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 3.05E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 3.71E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 4.21E-08 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 1.19E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 2.75E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 3.44E-06 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 1.45E-07 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 1.81E-11 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 8.72E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 2.95E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 6.28E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 8.40E-06 NA mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 1.98E-06 1.98E-06 mr1680_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 5.23E-06 mr1698_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 4.94E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 9.66E-07 2.42E-09 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 4.34E-08 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 2.48E-07 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224251301 NA 1.20E-08 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251