\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224249228:

Variant ID: vg0224249228 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24249228
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, A: 0.14, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCACGGCTAGTACCCTACGGTGTCTCCGGATACTGTCAGGAGAGACAAAAGCGCTATCTCTGATCTCGCCGGGCACAGATTCGAGGAGGAAGGCTACC[A/C,T]
TGTTGTCGACTACGAGTCAGACCTTCAAACCGTCATGTCGATAACAGTTAGATAGGCTATCCCAAATATTGTACTTGTGTGATTATGGTGAATAAGAGCA

Reverse complement sequence

TGCTCTTATTCACCATAATCACACAAGTACAATATTTGGGATAGCCTATCTAACTGTTATCGACATGACGGTTTGAAGGTCTGACTCGTAGTCGACAACA[T/G,A]
GGTAGCCTTCCTCCTCGAATCTGTGCCCGGCGAGATCAGAGATAGCGCTTTTGTCTCTCCTGACAGTATCCGGAGACACCGTAGGGTACTAGCCGTGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 32.30% 0.17% 0.00% T: 0.11%
All Indica  2759 81.50% 18.20% 0.14% 0.00% T: 0.18%
All Japonica  1512 36.40% 63.40% 0.26% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.00% 0.00% T: 0.17%
Indica II  465 70.30% 29.20% 0.43% 0.00% NA
Indica III  913 83.00% 16.90% 0.11% 0.00% NA
Indica Intermediate  786 74.30% 25.10% 0.13% 0.00% T: 0.51%
Temperate Japonica  767 24.50% 75.20% 0.26% 0.00% NA
Tropical Japonica  504 44.80% 55.20% 0.00% 0.00% NA
Japonica Intermediate  241 56.40% 42.70% 0.83% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 47.80% 52.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224249228 A -> T LOC_Os02g40040-LOC_Os02g40050 intergenic_region ; MODIFIER silent_mutation Average:76.39; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N
vg0224249228 A -> C LOC_Os02g40040-LOC_Os02g40050 intergenic_region ; MODIFIER silent_mutation Average:76.39; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224249228 A C 0.0 0.02 0.02 0.0 -0.01 0.0
vg0224249228 A T 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224249228 NA 1.73E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 4.96E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 6.06E-06 2.82E-09 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 3.15E-07 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 1.11E-06 9.71E-09 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 2.26E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 5.40E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 3.02E-09 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 4.48E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 8.13E-06 mr1146 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 8.63E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 3.61E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 2.17E-06 2.57E-08 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 1.20E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 2.16E-07 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 2.25E-06 3.34E-07 mr1256 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 8.36E-06 9.92E-08 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 1.68E-06 3.49E-06 mr1683 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 1.63E-06 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 1.63E-06 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 4.00E-06 1.00E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 4.66E-07 mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 8.07E-08 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 7.30E-09 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 2.42E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 8.37E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 1.89E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 2.66E-07 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249228 NA 9.24E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251