Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0224249043:

Variant ID: vg0224249043 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24249043
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGGTTTCCCTAGTTCTACTTGGACAAGGGGACACCTATGGGTATAAATACAAGCCCCAAGCCCCCCTTGGAGGAGAGAGGACACGAGAGAATCAACAC[C/T]
CACCATGGAGGATCAACACCTAACACAATCGACATAGAAGCCTACATACGCCAAGACACGCCGCCGGATATCGACTTCAGGGATAAGCACGGCTAGTACC

Reverse complement sequence

GGTACTAGCCGTGCTTATCCCTGAAGTCGATATCCGGCGGCGTGTCTTGGCGTATGTAGGCTTCTATGTCGATTGTGTTAGGTGTTGATCCTCCATGGTG[G/A]
GTGTTGATTCTCTCGTGTCCTCTCTCCTCCAAGGGGGGCTTGGGGCTTGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAAACCAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.00%	17.80%	0.21%	0.00%	NA
All Indica	2759	86.20%	13.70%	0.11%	0.00%	NA
All Japonica	1512	77.60%	22.00%	0.40%	0.00%	NA
Aus	269	70.60%	29.40%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	72.50%	27.10%	0.43%	0.00%	NA
Indica III	913	85.40%	14.60%	0.00%	0.00%	NA
Indica Intermediate	786	84.90%	15.00%	0.13%	0.00%	NA
Temperate Japonica	767	81.00%	18.50%	0.52%	0.00%	NA
Tropical Japonica	504	78.60%	21.40%	0.00%	0.00%	NA
Japonica Intermediate	241	65.10%	34.00%	0.83%	0.00%	NA
VI/Aromatic	96	57.30%	42.70%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224249043	C -> T	LOC_Os02g40040-LOC_Os02g40050	intergenic_region ; MODIFIER	silent_mutation	Average:58.189; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224249043	NA	7.59E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	4.90E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	3.99E-06	7.45E-09	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	4.16E-06	mr1043_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	8.96E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	8.10E-09	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	5.48E-06	mr1269_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	5.88E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	4.51E-06	1.19E-08	mr1479_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	1.30E-07	mr1502_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	5.21E-07	5.21E-07	mr1680_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	5.64E-07	mr1698_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	2.24E-07	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	1.09E-07	1.00E-10	mr1871_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	9.64E-08	mr1892_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224249043	NA	5.20E-07	mr1950_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251