\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224240409:

Variant ID: vg0224240409 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24240409
Reference Allele: CAlternative Allele: T,CCTCT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


ATTACTCCGTTGGCTTGTCCGGGTCATCCTCCTCAGGTTCTTCCTTGTCAGGATCATCCTCCTGTGGTTCCTCCTGAGGTTGTGGTTCTTCCTCTTCCTC[C/T,CCTCT]
TCCTCATCATCATCCAGAGGATCATCAGCTGGCAATGGATGGGGCAATGGTGTTTTCATAGGGCTGAATTTTGGGAAGATATCAGGCCTCCTCCCAGGCT

Reverse complement sequence

AGCCTGGGAGGAGGCCTGATATCTTCCCAAAATTCAGCCCTATGAAAACACCATTGCCCCATCCATTGCCAGCTGATGATCCTCTGGATGATGATGAGGA[G/A,AGAGG]
GAGGAAGAGGAAGAACCACAACCTCAGGAGGAACCACAGGAGGATGATCCTGACAAGGAAGAACCTGAGGAGGATGACCCGGACAAGCCAACGGAGTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 41.10% 0.23% 0.04% CCTCT: 1.31%
All Indica  2759 51.80% 45.70% 0.33% 0.07% CCTCT: 2.14%
All Japonica  1512 72.10% 27.70% 0.13% 0.00% CCTCT: 0.07%
Aus  269 32.00% 68.00% 0.00% 0.00% NA
Indica I  595 39.80% 59.50% 0.50% 0.17% NA
Indica II  465 83.00% 16.30% 0.65% 0.00% NA
Indica III  913 34.00% 60.50% 0.11% 0.00% CCTCT: 5.48%
Indica Intermediate  786 63.10% 35.40% 0.25% 0.13% CCTCT: 1.15%
Temperate Japonica  767 58.70% 40.90% 0.26% 0.00% CCTCT: 0.13%
Tropical Japonica  504 91.70% 8.30% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 0.00% 0.00% CCTCT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224240409 C -> CCTCT LOC_Os02g40040.1 frameshift_variant ; p.Glu114fs; HIGH frameshift_variant Average:90.584; most accessible tissue: Minghui63 young leaf, score: 96.569 N N N N
vg0224240409 C -> T LOC_Os02g40040.1 synonymous_variant ; p.Glu112Glu; LOW synonymous_codon Average:90.584; most accessible tissue: Minghui63 young leaf, score: 96.569 N N N N
vg0224240409 C -> DEL LOC_Os02g40040.1 N frameshift_variant Average:90.584; most accessible tissue: Minghui63 young leaf, score: 96.569 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224240409 C CCTCT -0.07 -0.1 -0.21 -0.06 -0.07 -0.06
vg0224240409 C T -0.02 -0.02 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224240409 NA 3.21E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 8.87E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 4.13E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 1.12E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 1.06E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 5.55E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 4.13E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 7.85E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 1.73E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 3.12E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 3.12E-06 1.64E-07 mr1074_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 1.58E-06 NA mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 1.65E-06 5.62E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 9.33E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 2.25E-07 9.45E-08 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 5.61E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224240409 NA 1.29E-08 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251