Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0224239569:

Variant ID: vg0224239569 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24239569
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

CAGCTTAATGTTATCGGGCAAGGTCTTGGCTTTCTTGGCTCTGGCTTGTATGCCTACTGCAAGATCAAAGGGAAGTAGATACGGATGTCCAGTGGGGGTC[T/A]
GAAGGAGAGTAGATATTGAAGTTTATTTTGGAGGGGCCAATGTGCCATACTGAAGTAGAGTTCGTGCTGTTTGCTCCTGCATATGGGAGAGAAATTTTGT

Reverse complement sequence

ACAAAATTTCTCTCCCATATGCAGGAGCAAACAGCACGAACTCTACTTCAGTATGGCACATTGGCCCCTCCAAAATAAACTTCAATATCTACTCTCCTTC[A/T]
GACCCCCACTGGACATCCGTATCTACTTCCCTTTGATCTTGCAGTAGGCATACAAGCCAGAGCCAAGAAAGCCAAGACCTTGCCCGATAACATTAAGCTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	38.20%	0.34%	0.02%	NA
All Indica	2759	52.80%	46.70%	0.40%	0.04%	NA
All Japonica	1512	81.70%	18.10%	0.26%	0.00%	NA
Aus	269	33.10%	66.50%	0.37%	0.00%	NA
Indica I	595	40.50%	59.30%	0.17%	0.00%	NA
Indica II	465	82.80%	16.80%	0.43%	0.00%	NA
Indica III	913	36.40%	63.30%	0.22%	0.11%	NA
Indica Intermediate	786	63.60%	35.60%	0.76%	0.00%	NA
Temperate Japonica	767	76.40%	23.50%	0.13%	0.00%	NA
Tropical Japonica	504	93.30%	6.50%	0.20%	0.00%	NA
Japonica Intermediate	241	74.30%	24.90%	0.83%	0.00%	NA
VI/Aromatic	96	60.40%	39.60%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224239569	T -> A	LOC_Os02g40030.1	3_prime_UTR_variant ; 23.0bp to feature; MODIFIER	silent_mutation	Average:87.761; most accessible tissue: Minghui63 young leaf, score: 93.48	N	N	N	N
vg0224239569	T -> A	LOC_Os02g40030.2	3_prime_UTR_variant ; 1018.0bp to feature; MODIFIER	silent_mutation	Average:87.761; most accessible tissue: Minghui63 young leaf, score: 93.48	N	N	N	N
vg0224239569	T -> A	LOC_Os02g40040.1	downstream_gene_variant ; 518.0bp to feature; MODIFIER	silent_mutation	Average:87.761; most accessible tissue: Minghui63 young leaf, score: 93.48	N	N	N	N
vg0224239569	T -> DEL	N	N	silent_mutation	Average:87.761; most accessible tissue: Minghui63 young leaf, score: 93.48	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0224239569	T	A	-0.03	-0.01	-0.01	-0.01	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224239569	NA	5.15E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569	NA	3.13E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569	NA	2.54E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569	NA	7.83E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569	8.78E-06	1.03E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569	1.45E-07	3.20E-06	mr1098_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569	3.65E-07	2.44E-06	mr1099_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569	NA	6.19E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569	1.73E-08	2.50E-08	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569	NA	4.57E-06	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251