\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224239569:

Variant ID: vg0224239569 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24239569
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCTTAATGTTATCGGGCAAGGTCTTGGCTTTCTTGGCTCTGGCTTGTATGCCTACTGCAAGATCAAAGGGAAGTAGATACGGATGTCCAGTGGGGGTC[T/A]
GAAGGAGAGTAGATATTGAAGTTTATTTTGGAGGGGCCAATGTGCCATACTGAAGTAGAGTTCGTGCTGTTTGCTCCTGCATATGGGAGAGAAATTTTGT

Reverse complement sequence

ACAAAATTTCTCTCCCATATGCAGGAGCAAACAGCACGAACTCTACTTCAGTATGGCACATTGGCCCCTCCAAAATAAACTTCAATATCTACTCTCCTTC[A/T]
GACCCCCACTGGACATCCGTATCTACTTCCCTTTGATCTTGCAGTAGGCATACAAGCCAGAGCCAAGAAAGCCAAGACCTTGCCCGATAACATTAAGCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 38.20% 0.34% 0.02% NA
All Indica  2759 52.80% 46.70% 0.40% 0.04% NA
All Japonica  1512 81.70% 18.10% 0.26% 0.00% NA
Aus  269 33.10% 66.50% 0.37% 0.00% NA
Indica I  595 40.50% 59.30% 0.17% 0.00% NA
Indica II  465 82.80% 16.80% 0.43% 0.00% NA
Indica III  913 36.40% 63.30% 0.22% 0.11% NA
Indica Intermediate  786 63.60% 35.60% 0.76% 0.00% NA
Temperate Japonica  767 76.40% 23.50% 0.13% 0.00% NA
Tropical Japonica  504 93.30% 6.50% 0.20% 0.00% NA
Japonica Intermediate  241 74.30% 24.90% 0.83% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224239569 T -> A LOC_Os02g40030.1 3_prime_UTR_variant ; 23.0bp to feature; MODIFIER silent_mutation Average:87.761; most accessible tissue: Minghui63 young leaf, score: 93.48 N N N N
vg0224239569 T -> A LOC_Os02g40030.2 3_prime_UTR_variant ; 1018.0bp to feature; MODIFIER silent_mutation Average:87.761; most accessible tissue: Minghui63 young leaf, score: 93.48 N N N N
vg0224239569 T -> A LOC_Os02g40040.1 downstream_gene_variant ; 518.0bp to feature; MODIFIER silent_mutation Average:87.761; most accessible tissue: Minghui63 young leaf, score: 93.48 N N N N
vg0224239569 T -> DEL N N silent_mutation Average:87.761; most accessible tissue: Minghui63 young leaf, score: 93.48 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224239569 T A -0.03 -0.01 -0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224239569 NA 5.15E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569 NA 3.13E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569 NA 2.54E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569 NA 7.83E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569 8.78E-06 1.03E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569 1.45E-07 3.20E-06 mr1098_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569 3.65E-07 2.44E-06 mr1099_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569 NA 6.19E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569 1.73E-08 2.50E-08 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224239569 NA 4.57E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251