\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224233343:

Variant ID: vg0224233343 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24233343
Reference Allele: ATCAlternative Allele: GTC,A
Primary Allele: GTCSecondary Allele: ATC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTCTTAATTGTCATTGGTATTTTAAAAATCGAACATAATTATCGTTTAGGTTCATTTTTTTTACTTTCTGGAAGTTCCACCAAAACGTCAGCGACTTT[ATC/GTC,A]
ACTGTACTCCAATACGGCTCGCCCGCTGCCTCCCTTCTTTACTCTCATTGAGATTTTATCATTGGTTTTTTTTACTTTTCATAAGCCCGAACCTTTTAAA

Reverse complement sequence

TTTAAAAGGTTCGGGCTTATGAAAAGTAAAAAAAACCAATGATAAAATCTCAATGAGAGTAAAGAAGGGAGGCAGCGGGCGAGCCGTATTGGAGTACAGT[GAT/GAC,T]
AAAGTCGCTGACGTTTTGGTGGAACTTCCAGAAAGTAAAAAAAATGAACCTAAACGATAATTATGTTCGATTTTTAAAATACCAATGACAATTAAGAGAA

Allele Frequencies:

Populations Population SizeFrequency of GTC(primary allele) Frequency of ATC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 36.10% 1.29% 0.59% A: 1.63%
All Indica  2759 73.00% 22.80% 1.74% 1.01% A: 1.38%
All Japonica  1512 36.80% 60.80% 0.20% 0.00% A: 2.18%
Aus  269 65.80% 29.70% 3.35% 0.00% A: 1.12%
Indica I  595 93.40% 1.20% 1.68% 3.53% A: 0.17%
Indica II  465 43.70% 52.90% 0.65% 0.43% A: 2.37%
Indica III  913 79.20% 16.40% 2.52% 0.00% A: 1.86%
Indica Intermediate  786 67.80% 28.90% 1.53% 0.64% A: 1.15%
Temperate Japonica  767 41.20% 55.90% 0.13% 0.00% A: 2.74%
Tropical Japonica  504 28.20% 71.80% 0.00% 0.00% NA
Japonica Intermediate  241 41.10% 53.10% 0.83% 0.00% A: 4.98%
VI/Aromatic  96 60.40% 37.50% 0.00% 0.00% A: 2.08%
Intermediate  90 50.00% 47.80% 1.11% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224233343 ATC -> A LOC_Os02g40020.1 upstream_gene_variant ; 4129.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> A LOC_Os02g40030.1 upstream_gene_variant ; 2324.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> A LOC_Os02g40030.2 upstream_gene_variant ; 2324.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> A LOC_Os02g40010.1 downstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> A LOC_Os02g40010.2 downstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> A LOC_Os02g40010.3 downstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> A LOC_Os02g40010.4 downstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> A LOC_Os02g40020-LOC_Os02g40030 intergenic_region ; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> GTC LOC_Os02g40020.1 upstream_gene_variant ; 4128.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> GTC LOC_Os02g40030.1 upstream_gene_variant ; 2325.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> GTC LOC_Os02g40030.2 upstream_gene_variant ; 2325.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> GTC LOC_Os02g40010.1 downstream_gene_variant ; 4577.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> GTC LOC_Os02g40010.2 downstream_gene_variant ; 4577.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> GTC LOC_Os02g40010.3 downstream_gene_variant ; 4577.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> GTC LOC_Os02g40010.4 downstream_gene_variant ; 4577.0bp to feature; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> GTC LOC_Os02g40020-LOC_Os02g40030 intergenic_region ; MODIFIER silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0224233343 ATC -> DEL N N silent_mutation Average:50.986; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224233343 2.78E-07 3.93E-13 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 1.66E-11 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 6.35E-06 NA mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 2.37E-07 8.47E-13 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 3.38E-09 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 6.11E-07 3.98E-13 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 4.89E-08 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.23E-07 2.88E-11 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 4.37E-06 NA mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 7.62E-07 2.50E-08 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 4.31E-07 7.65E-09 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 3.67E-07 1.51E-11 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 6.56E-10 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 7.10E-06 mr1146 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 1.10E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 6.26E-10 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 2.91E-08 2.76E-13 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 3.95E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 2.02E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 4.32E-07 1.84E-11 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 1.44E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 3.86E-06 1.69E-08 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 4.41E-08 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 1.28E-11 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 2.84E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 8.96E-07 NA mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 6.06E-08 3.16E-10 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 1.15E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 1.00E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 5.11E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 9.55E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 1.31E-07 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 3.74E-07 3.14E-08 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 3.54E-07 3.20E-08 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.27E-08 4.38E-14 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.11E-06 1.06E-08 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 4.75E-06 2.35E-10 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 6.12E-06 NA mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 2.09E-06 2.84E-08 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 8.63E-09 1.88E-13 mr1918 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.12E-09 9.55E-15 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 3.73E-06 2.07E-09 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 8.74E-08 1.70E-14 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 3.17E-06 6.28E-14 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 2.22E-07 5.02E-10 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 7.73E-13 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 1.77E-13 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 2.12E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.48E-06 6.67E-09 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 2.77E-07 7.84E-11 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 8.23E-08 1.51E-10 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 8.87E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.17E-07 1.75E-15 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.97E-06 8.69E-07 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 3.95E-07 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 5.34E-13 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 5.96E-09 1.35E-15 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 5.29E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.19E-06 6.18E-09 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 1.70E-13 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 4.69E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 2.37E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 3.48E-14 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 3.17E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.28E-06 3.75E-10 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 8.40E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 1.42E-06 3.08E-07 mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 NA 2.79E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224233343 6.67E-06 5.51E-15 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251