| Variant ID: vg0224229948 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24229948 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 96. )
TTGTATTTTTTTTTTGTTACATTCGGCTTACAACAAGCGTAACTTTCTCATACGGACTCGGAATCAGGCAGATAATATATCCACGGACATTTATAGAAAA[G/A,T]
GTTATATTCAATTCTCCCCCGCTTTGCTGGGTTCAGCAAAATTAGAATCTCCAAATTCTACTTGCAAGATTATGTTTTCGAGGCGAGAAACTTTTCGGTA
TACCGAAAAGTTTCTCGCCTCGAAAACATAATCTTGCAAGTAGAATTTGGAGATTCTAATTTTGCTGAACCCAGCAAAGCGGGGGAGAATTGAATATAAC[C/T,A]
TTTTCTATAAATGTCCGTGGATATATTATCTGCCTGATTCCGAGTCCGTATGAGAAAGTTACGCTTGTTGTAAGCCGAATGTAACAAAAAAAAAATACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 39.90% | 0.78% | 2.69% | T: 0.06% |
| All Indica | 2759 | 45.70% | 48.90% | 0.83% | 4.49% | T: 0.07% |
| All Japonica | 1512 | 80.80% | 18.90% | 0.13% | 0.13% | T: 0.07% |
| Aus | 269 | 30.90% | 67.30% | 1.86% | 0.00% | NA |
| Indica I | 595 | 37.80% | 59.50% | 0.50% | 2.18% | NA |
| Indica II | 465 | 74.80% | 18.70% | 0.86% | 5.38% | T: 0.22% |
| Indica III | 913 | 30.40% | 67.90% | 0.99% | 0.66% | NA |
| Indica Intermediate | 786 | 52.30% | 36.50% | 0.89% | 10.18% | T: 0.13% |
| Temperate Japonica | 767 | 75.70% | 23.90% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 25.70% | 0.41% | 0.00% | T: 0.41% |
| VI/Aromatic | 96 | 53.10% | 39.60% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224229948 | G -> A | LOC_Os02g40020.1 | upstream_gene_variant ; 733.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> A | LOC_Os02g40010.1 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> A | LOC_Os02g40010.2 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> A | LOC_Os02g40010.3 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> A | LOC_Os02g40010.4 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> A | LOC_Os02g40020-LOC_Os02g40030 | intergenic_region ; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> T | LOC_Os02g40020.1 | upstream_gene_variant ; 733.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> T | LOC_Os02g40010.1 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> T | LOC_Os02g40010.2 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> T | LOC_Os02g40010.3 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> T | LOC_Os02g40010.4 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> T | LOC_Os02g40020-LOC_Os02g40030 | intergenic_region ; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| vg0224229948 | G -> DEL | N | N | silent_mutation | Average:53.725; most accessible tissue: Minghui63 flower, score: 76.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224229948 | NA | 6.32E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 9.31E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 5.08E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 1.98E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 1.68E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 1.53E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 6.08E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 6.03E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 4.72E-08 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 1.78E-07 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | 6.02E-06 | 3.41E-07 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | 1.56E-07 | 1.68E-06 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | 1.20E-06 | 2.18E-06 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 2.77E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 3.51E-08 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | 1.73E-08 | 7.77E-09 | mr1150_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 2.05E-06 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 2.39E-06 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224229948 | NA | 7.24E-09 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |