\
| Variant ID: vg0224209424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24209424 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGGAGCTAGGTGAATAGATCCATGCAATAGCAGTAAAGTTTTTTTTTTCTAACGTCAGGCTACTGCCAACGTTTTATATAAAGAAGGTGTCTCATTTTAA[G/A]
AAGTAAACATAATTAAATTTTACAGTGCCTAATTAATTAGGAAAAACTGAGCGAAAACTATAACTACAATAACACACCAACAGCTAACCTAACCTAAGCT
AGCTTAGGTTAGGTTAGCTGTTGGTGTGTTATTGTAGTTATAGTTTTCGCTCAGTTTTTCCTAATTAATTAGGCACTGTAAAATTTAATTATGTTTACTT[C/T]
TTAAAATGAGACACCTTCTTTATATAAAACGTTGGCAGTAGCCTGACGTTAGAAAAAAAAAACTTTACTGCTATTGCATGGATCTATTCACCTAGCTCCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.70% | 1.90% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.40% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 94.50% | 4.70% | 0.79% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 3.80% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.60% | 14.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224209424 | G -> A | LOC_Os02g40000-LOC_Os02g40010 | intergenic_region ; MODIFIER | silent_mutation | Average:50.911; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224209424 | 7.35E-07 | 3.42E-06 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | 9.60E-06 | 6.34E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | NA | 5.89E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | 3.07E-07 | 4.10E-08 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | 4.95E-06 | NA | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | 1.41E-06 | 4.68E-07 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | NA | 5.78E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | 1.13E-06 | 3.75E-07 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | 4.13E-06 | 7.24E-06 | mr1858 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | 4.13E-06 | 7.24E-06 | mr1859 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | 3.79E-07 | 1.84E-07 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | 1.35E-08 | 1.54E-08 | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224209424 | NA | 6.85E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |