\
| Variant ID: vg0224207984 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24207984 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 259. )
TTTTGTGGTTATTTGCGGGTACGGAACGAAATGCGGGTACGTGGAAGAGACGGAATTAATCATGGAAATGATTTCACCATGAAAATGGCACAAGGCAGTG[A/C]
TCACATTTGTGTCTTATGCCTGATAACGACCGGGGCCTCCTTTGGATTTGGATGAACTTCTGTAAAAATCCTGTAAAATTCTTATAAAAATTTGGTGAAT
ATTCACCAAATTTTTATAAGAATTTTACAGGATTTTTACAGAAGTTCATCCAAATCCAAAGGAGGCCCCGGTCGTTATCAGGCATAAGACACAAATGTGA[T/G]
CACTGCCTTGTGCCATTTTCATGGTGAAATCATTTCCATGATTAATTCCGTCTCTTCCACGTACCCGCATTTCGTTCCGTACCCGCAAATAACCACAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 10.30% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 91.00% | 8.80% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 86.90% | 12.40% | 0.66% | 0.00% | NA |
| Aus | 269 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.90% | 13.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 91.10% | 8.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 85.70% | 13.20% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 30.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 16.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224207984 | A -> C | LOC_Os02g40000-LOC_Os02g40010 | intergenic_region ; MODIFIER | silent_mutation | Average:61.133; most accessible tissue: Minghui63 flower, score: 84.277 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224207984 | 2.63E-06 | 3.94E-08 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 1.81E-06 | 1.81E-06 | mr1373 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | NA | 4.24E-08 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 5.07E-06 | 1.77E-07 | mr1445 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 5.69E-06 | 6.50E-06 | mr1513 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 1.86E-06 | NA | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 6.74E-07 | NA | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 5.51E-08 | NA | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 3.90E-07 | NA | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 3.56E-08 | NA | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 1.74E-06 | NA | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224207984 | 6.72E-07 | NA | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |