\
| Variant ID: vg0224190332 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24190332 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCTAATCCTCAATTAATAAATGCATTTAATAATCAAATTCGGCGTGGTGGAATTTTTCTTGAGTTCCCCATGCTCCAATACATTAACAAGACTTTTAGTG[C/G]
AATTTTCAGAGCTCTCGAAATAATTTTAACCAATTAAAATTGAGCACATGCAATTTTTAAATCCCAGGGAAAATCTTTTCCTCCTTTTCTTTTTCTTTTC
GAAAAGAAAAAGAAAAGGAGGAAAAGATTTTCCCTGGGATTTAAAAATTGCATGTGCTCAATTTTAATTGGTTAAAATTATTTCGAGAGCTCTGAAAATT[G/C]
CACTAAAAGTCTTGTTAATGTATTGGAGCATGGGGAACTCAAGAAAAATTCCACCACGCCGAATTTGATTATTAAATGCATTTATTAATTGAGGATTAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.90% | 10.50% | 2.05% | 34.62% | NA |
| All Indica | 2759 | 39.00% | 5.50% | 3.23% | 52.34% | NA |
| All Japonica | 1512 | 78.10% | 18.00% | 0.13% | 3.77% | NA |
| Aus | 269 | 49.40% | 11.50% | 1.49% | 37.55% | NA |
| Indica I | 595 | 39.20% | 1.00% | 2.18% | 57.65% | NA |
| Indica II | 465 | 51.20% | 4.50% | 1.08% | 43.23% | NA |
| Indica III | 913 | 22.60% | 7.60% | 5.37% | 64.51% | NA |
| Indica Intermediate | 786 | 50.60% | 7.00% | 2.80% | 39.57% | NA |
| Temperate Japonica | 767 | 80.40% | 17.50% | 0.26% | 1.83% | NA |
| Tropical Japonica | 504 | 81.20% | 11.10% | 0.00% | 7.74% | NA |
| Japonica Intermediate | 241 | 64.30% | 34.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 51.00% | 36.50% | 1.04% | 11.46% | NA |
| Intermediate | 90 | 66.70% | 6.70% | 1.11% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224190332 | C -> G | LOC_Os02g39990-LOC_Os02g40000 | intergenic_region ; MODIFIER | silent_mutation | Average:51.971; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0224190332 | C -> DEL | N | N | silent_mutation | Average:51.971; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224190332 | 4.42E-06 | NA | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224190332 | 7.20E-06 | NA | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224190332 | 3.03E-06 | NA | mr1098_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224190332 | 3.34E-06 | NA | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224190332 | 1.82E-06 | NA | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224190332 | 1.26E-06 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224190332 | 2.83E-06 | 9.05E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224190332 | 3.67E-06 | NA | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224190332 | 2.96E-06 | NA | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |