\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224159749:

Variant ID: vg0224159749 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24159749
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTTGCCATAAGCATAACGTCATTGCAACTAATAATCACCAATGCTTAGATATGAACATTTTGGTTAATGAGTGCCACTGGTATGGTATGACATTAAC[T/C,G]
TTATATGCTGCTCTATTGTTTTATTGAATGAAGGCAGAAGTAACTTGATGAATTTGCTGAAACTGCTTGCCATGACAGGTACATCTTTTTTGTGACATTG

Reverse complement sequence

CAATGTCACAAAAAAGATGTACCTGTCATGGCAAGCAGTTTCAGCAAATTCATCAAGTTACTTCTGCCTTCATTCAATAAAACAATAGAGCAGCATATAA[A/G,C]
GTTAATGTCATACCATACCAGTGGCACTCATTAACCAAAATGTTCATATCTAAGCATTGGTGATTATTAGTTGCAATGACGTTATGCTTATGGCAACTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 3.20% 0.04% 0.00% G: 0.04%
All Indica  2759 99.30% 0.70% 0.04% 0.00% NA
All Japonica  1512 91.50% 8.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.13% 0.00% NA
Temperate Japonica  767 95.40% 4.60% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 3.80% 0.20% 0.00% NA
Japonica Intermediate  241 69.30% 30.70% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 0.00% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224159749 T -> G LOC_Os02g39940.1 upstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 N N N N
vg0224159749 T -> G LOC_Os02g39960.1 downstream_gene_variant ; 3804.0bp to feature; MODIFIER silent_mutation Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 N N N N
vg0224159749 T -> G LOC_Os02g39950.1 intron_variant ; MODIFIER silent_mutation Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 N N N N
vg0224159749 T -> C LOC_Os02g39940.1 upstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 N N N N
vg0224159749 T -> C LOC_Os02g39960.1 downstream_gene_variant ; 3804.0bp to feature; MODIFIER silent_mutation Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 N N N N
vg0224159749 T -> C LOC_Os02g39950.1 intron_variant ; MODIFIER silent_mutation Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224159749 3.56E-07 6.35E-06 mr1101 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 2.79E-06 3.25E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 4.59E-07 1.03E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 5.76E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 1.76E-06 3.60E-09 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 5.02E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 1.91E-06 2.45E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 7.06E-06 1.69E-08 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 1.20E-06 1.01E-06 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 5.84E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 2.64E-06 2.77E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 2.36E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 1.66E-07 2.24E-09 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 9.39E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 4.99E-09 4.45E-12 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 4.26E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 4.27E-06 4.44E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 4.27E-06 4.44E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 4.84E-08 1.64E-09 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 1.42E-07 3.98E-09 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 5.08E-06 2.06E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 2.16E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 1.12E-06 3.91E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 2.07E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 8.31E-06 2.73E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 1.67E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 1.16E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 3.00E-08 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 1.13E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 1.39E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 3.19E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224159749 NA 6.64E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251