\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224129317:

Variant ID: vg0224129317 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24129317
Reference Allele: AAlternative Allele: C,G
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, C: 0.02, G: 0.02, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGGAAAGTCCAATGCATGTGACGTGCAAGTGTACCTGTAGTCCATTTAGCCCCTATTTACTTCACACCAAACTTCCCCCAAACTCCCAACTTTTCATT[A/C,G]
TATCACATCACATCAAAAACTTTCCTACTCACATAAATTTCTAACTTTTTTTTTCCAAACTTCTTCCCCAATTTCAAAAACTAAACACAGCCTTAGTACT

Reverse complement sequence

AGTACTAAGGCTGTGTTTAGTTTTTGAAATTGGGGAAGAAGTTTGGAAAAAAAAAGTTAGAAATTTATGTGAGTAGGAAAGTTTTTGATGTGATGTGATA[T/G,C]
AATGAAAAGTTGGGAGTTTGGGGGAAGTTTGGTGTGAAGTAAATAGGGGCTAAATGGACTACAGGTACACTTGCACGTCACATGCATTGGACTTTCCCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 30.30% 0.02% 0.00% G: 0.89%
All Indica  2759 49.60% 49.80% 0.00% 0.00% G: 0.62%
All Japonica  1512 97.00% 2.80% 0.07% 0.00% G: 0.20%
Aus  269 94.80% 1.10% 0.00% 0.00% G: 4.09%
Indica I  595 50.40% 49.60% 0.00% 0.00% NA
Indica II  465 47.10% 52.70% 0.00% 0.00% G: 0.22%
Indica III  913 48.60% 50.40% 0.00% 0.00% G: 0.99%
Indica Intermediate  786 51.70% 47.50% 0.00% 0.00% G: 0.89%
Temperate Japonica  767 98.30% 1.60% 0.13% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 0.80% 0.00% 0.00% G: 1.24%
VI/Aromatic  96 85.40% 4.20% 0.00% 0.00% G: 10.42%
Intermediate  90 85.60% 13.30% 0.00% 0.00% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224129317 A -> G LOC_Os02g39910.1 downstream_gene_variant ; 3866.0bp to feature; MODIFIER silent_mutation Average:84.059; most accessible tissue: Zhenshan97 panicle, score: 95.806 N N N N
vg0224129317 A -> G LOC_Os02g39900-LOC_Os02g39910 intergenic_region ; MODIFIER silent_mutation Average:84.059; most accessible tissue: Zhenshan97 panicle, score: 95.806 N N N N
vg0224129317 A -> C LOC_Os02g39910.1 downstream_gene_variant ; 3866.0bp to feature; MODIFIER silent_mutation Average:84.059; most accessible tissue: Zhenshan97 panicle, score: 95.806 N N N N
vg0224129317 A -> C LOC_Os02g39900-LOC_Os02g39910 intergenic_region ; MODIFIER silent_mutation Average:84.059; most accessible tissue: Zhenshan97 panicle, score: 95.806 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224129317 A C 0.01 -0.01 0.0 0.04 0.02 0.03
vg0224129317 A G -0.04 -0.05 -0.03 0.03 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224129317 6.03E-06 1.67E-06 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 4.57E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 7.36E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 6.33E-06 NA mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 1.53E-06 5.30E-08 mr1130 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 5.42E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 8.21E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 1.37E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 1.44E-06 mr1222 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 1.85E-06 NA mr1254 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 7.67E-07 7.01E-07 mr1254 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 7.39E-06 NA mr1256 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 9.05E-06 NA mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 4.28E-06 2.73E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 6.58E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 1.27E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 1.83E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 2.42E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224129317 NA 1.34E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251