Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224117343:

Variant ID: vg0224117343 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24117343
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

ATACTAGTAGCAACTAGATATGAGATTGAGGTAGCTAGTTATGACCATACAGAGAGCGATCTCGTTGTAGACGCGTCCTTTTTTTATTTCAGTACATACT[G/A]
AGACTGATATACTATTATATAGTGGTTGCAAAATTAGTTATATTTACACATCTCCAATTTTATAGGTTATGTTTTGTTAGCTAGTGATCCAAATATAACA

Reverse complement sequence

TGTTATATTTGGATCACTAGCTAACAAAACATAACCTATAAAATTGGAGATGTGTAAATATAACTAATTTTGCAACCACTATATAATAGTATATCAGTCT[C/T]
AGTATGTACTGAAATAAAAAAAGGACGCGTCTACAACGAGATCGCTCTCTGTATGGTCATAACTAGCTACCTCAATCTCATATCTAGTTGCTACTAGTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.60%	25.40%	0.04%	0.00%	NA
All Indica	2759	58.30%	41.60%	0.04%	0.00%	NA
All Japonica	1512	97.40%	2.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	51.60%	48.20%	0.17%	0.00%	NA
Indica II	465	48.80%	51.20%	0.00%	0.00%	NA
Indica III	913	68.80%	31.20%	0.00%	0.00%	NA
Indica Intermediate	786	56.90%	43.10%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	94.40%	5.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224117343	G -> A	LOC_Os02g39900.1	upstream_gene_variant ; 3303.0bp to feature; MODIFIER	silent_mutation	Average:30.48; most accessible tissue: Callus, score: 54.534	N	N	N	N
vg0224117343	G -> A	LOC_Os02g39900-LOC_Os02g39910	intergenic_region ; MODIFIER	silent_mutation	Average:30.48; most accessible tissue: Callus, score: 54.534	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224117343	2.88E-06	2.99E-07	mr1081	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	7.23E-07	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	3.50E-06	mr1207	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	1.41E-07	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	6.47E-06	mr1215	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	8.83E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	9.49E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	1.54E-06	mr1222	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	4.47E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	5.43E-08	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	1.85E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	2.46E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343	NA	4.33E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251