\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224117343:

Variant ID: vg0224117343 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24117343
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTAGTAGCAACTAGATATGAGATTGAGGTAGCTAGTTATGACCATACAGAGAGCGATCTCGTTGTAGACGCGTCCTTTTTTTATTTCAGTACATACT[G/A]
AGACTGATATACTATTATATAGTGGTTGCAAAATTAGTTATATTTACACATCTCCAATTTTATAGGTTATGTTTTGTTAGCTAGTGATCCAAATATAACA

Reverse complement sequence

TGTTATATTTGGATCACTAGCTAACAAAACATAACCTATAAAATTGGAGATGTGTAAATATAACTAATTTTGCAACCACTATATAATAGTATATCAGTCT[C/T]
AGTATGTACTGAAATAAAAAAAGGACGCGTCTACAACGAGATCGCTCTCTGTATGGTCATAACTAGCTACCTCAATCTCATATCTAGTTGCTACTAGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 25.40% 0.04% 0.00% NA
All Indica  2759 58.30% 41.60% 0.04% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 51.60% 48.20% 0.17% 0.00% NA
Indica II  465 48.80% 51.20% 0.00% 0.00% NA
Indica III  913 68.80% 31.20% 0.00% 0.00% NA
Indica Intermediate  786 56.90% 43.10% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224117343 G -> A LOC_Os02g39900.1 upstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:30.48; most accessible tissue: Callus, score: 54.534 N N N N
vg0224117343 G -> A LOC_Os02g39900-LOC_Os02g39910 intergenic_region ; MODIFIER silent_mutation Average:30.48; most accessible tissue: Callus, score: 54.534 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224117343 2.88E-06 2.99E-07 mr1081 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 7.23E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 3.50E-06 mr1207 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 1.41E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 6.47E-06 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 8.83E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 9.49E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 1.54E-06 mr1222 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 4.47E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 5.43E-08 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 1.85E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 2.46E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224117343 NA 4.33E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251